A real-time PCR for the detection of P. falciparum was performed according to a modified version of a previously described procedure [17 (link)]. Briefly, the mixture contained: 1 × Taqman Universal PCR Master Mix (Applied Biosystems, USA), 200 nM P. falciparum primers and probe, 15 µM primers and 5 µM probe of the host β-globin as internal positive control and 5 µl of DNA template in a total volume of 25 µl. Assays were run on an ABI 7500 Fast real-time thermocycler (Applied Biosystems, USA) at the Laboratory of Molecular Biology of the School of Medicine, University of Kinshasa, DRC.
Abi 7500 fast real time thermocycler
Manufactured by Thermo Fisher Scientific
Sourced in United States
The ABI 7500 Fast real-time thermocycler is a laboratory instrument used for nucleic acid amplification and detection. It is a fast, 96-well thermal cycler designed for real-time PCR applications.
Automatically generated - may contain errors
Lab products found in correlation
Taqman universal pcr master mix, by Thermo Fisher Scientific (3 mentions)
Nucleospin rna plant kit, by Macherey-Nagel (1 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Rneasy rna isolation kit, by Qiagen (1 mentions)
5 protocols using abi 7500 fast real time thermocycler
1
Real-time PCR for P. falciparum Detection
2
Quantifying Arabidopsis Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted and purified with Nucleospin RNA Plant kit (Macherey-Nagel, Düren Germany), reverse transcribed with M-MuLV Reverse transcriptase (RNase H minus) and oligo-dT, and the resulting cDNA was quantified by reverse transcription quantitative PCR with an Applied Biosystems (Waltham, MA, USA) ABI 7500 Fast Real-Time Thermocycler by using specific primer pairs for NIA1, NIA2, and NLP7, with ACT2 as a reference gene (Supplemental Table S3 ).
3
Rapid qPCR Detection of P. falciparum
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A real-time PCR for the detection of P. falciparum was performed according to a modified procedure previously described [18 (link)], as follows: 200 nM of P. falciparum primers and probe, a volume of 2.5 μl of Double-Dye Probe/Primer for Internal Positive Control (IPC), 2.5 μl of DNA virus culture (DIA-EIC/DNA(Cy5) for IPC, 12.5 μl of 2X Taqman Universal PCR Master Mix (Applied Biosystems) and water to make a final volume of 25 μl including 5 μl of DNA sample. Assays were run on an ABI 7500 Fast real-time thermocycler (Applied Biosystems).
4
Real-time PCR for Detecting P. falciparum
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A real-time PCR for the detection of P. falciparum was performed according to a modified procedure previously described [24 (link)]. Briefly, the mix contained 200 nM of P. falciparum primers and probe, a volume of 2.5 µl of Double-Dye Probe/Primer for Internal Positive Control (IPC), 2.5 µl of DNA virus culture (DIA-EIC/DNACy5) for IPC, 12.5 µl of 2× Taqman Universal PCR Master Mix (Applied Biosystems) and water to reach a total volume of 25 µl including 5 µl of DNA template. Assays were run on an ABI 7500 Fast real-time thermocycler (Applied Biosystems).
5
Quantitative Real-Time RT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the RNeasy RNA isolation kit (Qiagen) as recommended by the supplier. Triplicate RNA samples were prepared for each treatment group. RNA was reverse transcribed using SuperScript II reverse transcriptase (Invitrogen) in accordance with manufacturer's instructions. The PCR reaction was then carried out on an ABI 7500 fast real-time thermocycler (Applied Biosystems) using the SYBR green master mix (Applied Biosystems) and 150 nM each of both the forward and reverse primers. The cycling conditions were 50 C for 2 min, 95 C for 10 min, followed by 40 cycles at 95 C for 15 s and 60 C for 30 s. The sequences of the primers used are as follows: pS2, forward 5 0 e CCTCCCAGTGTGCAAATAAGGe3 0 and reverse 5 0 eTCTTCTGGAGG-GACGTCGATe3'; b-actin, forward 5 0 eCCCTGGCACCCAGCACe3 0 and reverse 5 0 eGCCGATCCACACGGAGTACe3'. The fold change for each gene was calculated using the cycle threshold (DDC T ) method as previously described (Livak and Schmittgen, 2001) , and data are represented as E2-mediated fold change over vehicle-treated samples. For each sample, real-time quantitative reverse transcription-PCRs (qRT-PCRs) were done in triplicate for both the gene of interest (pS2) and the reference gene (b-actin) to normalize for input cDNA.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!