Log In Sign up
The largest database of trusted experimental protocols

Sybr green intercalating dye

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States

SYBR Green is a fluorescent dye that binds to double-stranded DNA. It is commonly used in real-time PCR applications to detect and quantify DNA sequences.

Automatically generated - may contain errors

Lab products found in correlation

Trizol, by Thermo Fisher Scientific (5 mentions) High capacity cdna reverse transcription, by Thermo Fisher Scientific (2 mentions) Gdna eliminator column, by Qiagen (2 mentions) Rneasy plus mini kit, by Qiagen (2 mentions) Trizol reagent, by Thermo Fisher Scientific (2 mentions) Quick rna microprep kit, by Zymo Research (1 mentions) Superscript 2, by Thermo Fisher Scientific (1 mentions) Steponeplus, by Thermo Fisher Scientific (1 mentions)

7 protocols using sybr green intercalating dye

1

Cardiac Gene Expression Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from 15 whole, beating heart tubes cleaned of any excess fat or debris with a fine micropipette by Zymo Research Quick RNA MicroPrep kit. This collection of 15 hearts constituted one biological replicate. RNA concentration and purity was verified via Nanodrop. Reverse transcription to synthesize first strand cDNA was performed on equal quantities of RNA per sample. For quantitative PCR each reaction was run with 1 µL template cDNA, 2.5 µL each forward and reverse primer, 6.5 µL DEPC water, and 12.5 µL SYBR-green intercalating dye (Applied Biosystems). Each gene was analyzed for at least 4 biological replicates per genotype and age and absolute quantity was calculated by comparison to a standard curve for data in Supplemental Figure S3. For wildtype values were reported normalized aged/adult and for the transgenics they were first normalized to housekeeper GapDH2 and then displayed as a ratio of given genotype/control quantity. The primers used were presented in 5’ to 3’: Pericardin Fwd (CGGAGGACAGGCTACAATAA) Rev (CCAATACCAGGCTGACCTATAA), LamininA Fwd (GTTCTTCTACGGCAGGGATAAG) Rev (CTCCACCTTCACCCAAACTAA), Viking Fwd (GATCTACGACAACACTGGTGAG) Rev (TTCGCCACGAAGTCCAATAG), Myospheriod (β1-integrin) Fwd (AAACACTGCGAGTGCGACAAC) Rev (ACATGTATCGTTGGACTCCTG), GapDH2 Fwd (TTCTTCAGCGACACCCATTC) Rev (CGTTGTCGTACCACGAGATTAG).
Sessions A.O., Kaushik G., Parker S., Raedschelders K., Bodmer R., Van Eyk J.E, & Engler A.J. (2016). Extracellular Matrix Downregulation in the Drosophila Heart Preserves Contractile Function and Improves Lifespan. Matrix biology : journal of the International Society for Matrix Biology, 62, 15-27.
+ Open protocol
+ Expand
2

Quantification of Viral Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from HT-29 cells, transfected with either cont-shRNA or viperin-shRNA, using TRIzol (Invitrogen, Grand Island, NY, USA), according to the manufacturer’s instructions. Next, 500 ng of RNA from each sample were used to prepare cDNA, using the Superscript II reverse transcriptase (Invitrogen) with random hexamer primers by incubating at 42 °C for 1 h. Real-time PCR reactions (50 °C, 2 min; 95 °C, 10 min; 40 cycles of 95 °C, 15 s and 60 °C, 30 s; and 72 °C, 10 min) were performed in triplicate using SYBR Green intercalating dye (Applied Biosystems, Foster City, CA, USA) with primers specific for vp6 (FP:5′-CAGTGATTCTCAGGCCGAATA-3′; RP: 5′-GGCGAGTACAGACTCACAAA-3′) and gapdh (FP: 5′-GTCAACGGATTTGGTCGTATTG-3′; RP: 5′-TGGAAGATGGTGATGGGATTT-3′) in Step One Plus (Applied Biosystems). The viral gene expressions were normalized to the gapdh transcript, using the formula 2−ΔCT (ΔCT = CT vip-shRNA-CT cont-shRNA), where CT was the threshold cycle and data was represented as “relative fold change of viral transcript compared to GAPDH transcript”. Each bar denoted the mean fold chance ± SD of three independent experiments. The p values were calculated using an unpaired Student’s t test.
Sarkar R., Nandi S., Lo M., Gope A, & Chawla-Sarkar M. (2021). Viperin, an IFN-Stimulated Protein, Delays Rotavirus Release by Inhibiting Non-Structural Protein 4 (NSP4)-Induced Intrinsic Apoptosis. Viruses, 13(7), 1324.
+ Open protocol
+ Expand
3

Gene Expression Analysis in HUVECs and MK

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from HUVECs and MK precursors (day 14) was extracted using TRIzol (Invitrogen, Carlsbad, CA, USA) and cDNA was synthetized following the manufacturer’s instructions (Promega Corporation, Fitchburg, WI, USA). Gene expression for ISG20L2, RRNAD1, MRPL24, HDGF, PRCC and PEAR1 was measured using IDT PrimeTime qPCR Primers (Hs.PT.58.39252767, Hs.PT.58.21044077, Hs.PT.58.39042018, Hs.PT.58.97775, Hs.PT.58.21039953 and Hs.PT.58.40290082, respectively) and in-house designed primers for GAPDH (Forward primer: 5′-CTCAGACACCATGGGGAAG-3′ and Reverse primer: 5′-ACGGTGCCATGGAATTTGCC-3′) combined with SYBR green intercalating dye from Life Technologies. Gene expression data were analysed as ratio between each gene’s expression normalized to GAPDH and PEAR1 expression normalized to GAPDH.
Izzi B., Noro F., Cludts K., Freson K, & Hoylaerts M.F. (2018). Cell-Specific PEAR1 Methylation Studies Reveal a Locus that Coordinates Expression of Multiple Genes. International Journal of Molecular Sciences, 19(4), 1069.
+ Open protocol
+ Expand
4

Gene Expression Analysis of SPP1, COL2A1, and αSM

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using Trizol (Invitrogen, Carlsbad, CA) and cDNA was synthetized following the manufacturer’s instructions (Promega Corporation). Gene expression for SPP1 and COL2A1 was measured using IDT PrimeTime qPCR primers Hs.PT.58.19252426 (Forward primer: 5’-ttcaactcctcgctttccat-3’ Reverse primer: 5’-ccccacagtagacacatatgatg-3’) and Hs.PT.58.19672697 (Forward primer: 5’-attccatctgttccagggttac-3’ Reverse primer: 5’-ctggagccaagggtgaa-3’), respectively, combined with SYBR green intercalating dye from Life Technologies. Gene expression data were normalized against GAPDH expression calculated using in-house designed primers (Forward primer: 5’-ctcagacaccatggggaag-3’ and Reverse primer: 5’-acggtgccatggaatttgcc-3’). The expression of human αSM was also measured via mRNA expression measurements (Forward primer: 5’-tggtgtgtgacaatggctct-3’ Reverse primer: 5’-cttttccatgtcgtcccagt-3’).
Bolean M., Izzi B., van kerckhoven S., Bottini M., Ramos A.P., Millán J.L., Hoylaerts M.F, & Ciancaglini P. (2020). Matrix vesicle biomimetics harboring Annexin A5 and Alkaline Phosphatase bind to the native collagen matrix produced by mineralizing vascular smooth muscle cells. Biochimica et biophysica acta. General subjects, 1864(8), 129629.
+ Open protocol
+ Expand
5

Tissue RNA Extraction and qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tissues were harvested and lysed by adding 500µL Trizol (Life Technologies) directly to the tissue culture well and storing at −80°C. For extraction, lysate was thawed on ice, 100µL chloroform was added, vortexed for 30 seconds, and centrifuged at 12,000g for 15 minutes at 4°C. After centrifugation the aqueous phase was transferred to a QIAGEN gDNA eliminator column and centrifuged at 10,000g for 1 minute at room temperature. The flow-through was mixed with an equal volume of 70% EtOH and transferred to an RNEasy mini spin column. The manufacturer protocol for the RNEasy Plus Mini Kit (QIAGEN) was followed for the rest of the procedure. cDNA was synthesized using the high Capacity cDNA reverse transcription (Applied Biosystems). qRT-PCR was performed using the SYBR Green intercalating dye (ThermoFisher Scientific). Expression was normalized to 18S ribosomal RNA and relative gene expression was calculated using 2−ΔΔCT method. Primers used for qRT-PCR are listed in Table S1.
Velazquez J.J., LeGraw R., Moghadam F., Tan Y., Kilbourne J., Maggiore J.C., Hislop J., Liu S., Cats D., de Sousa Lopes S.M., Plaisier C., Cahan P., Kiani S, & Ebrahimkhani M.R. (2020). Gene Regulatory Network Analysis and Engineering Directs Development and Vascularization of Multilineage Human Liver Organoids. Cell systems, 12(1), 41-55.e11.
+ Open protocol
+ Expand
6

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using Trizol reagent (Thermo Fisher Scientific, Inc.). The synthesis of cDNA was performed on DNaseI-treated total RNA templates (0.5 μg) using an iscript™ cDNA synthesis kit. Gene expression was assessed by quantitative real-time PCR (qRT-PCR) using SYBR Green intercalating dye (Thermo Fisher Scientific, Inc.) and mouse primers. The primer sequences are presented in Additional file 1: Table S1. The comparative threshold cycle method was used to calculate the amplification fold as specified by the manufacturer. The amplified PCR products were separated by gel electrophoresis in a 2 % agarose gel visualized with ethidium bromide. Each sample was replicated at least three times.
Chen J., Gu Z., Wu M., Yang Y., Zhang J., Ou J., Zuo Z., Wang J, & Chen Y. (2016). C-reactive protein can upregulate VEGF expression to promote ADSC-induced angiogenesis by activating HIF-1α via CD64/PI3k/Akt and MAPK/ERK signaling pathways. Stem Cell Research & Therapy, 7, 114.
+ Open protocol
+ Expand
7

Tissue RNA Extraction and qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tissues were harvested and lysed by adding 500µL Trizol (Life Technologies) directly to the tissue culture well and storing at −80°C. For extraction, lysate was thawed on ice, 100µL chloroform was added, vortexed for 30 seconds, and centrifuged at 12,000g for 15 minutes at 4°C. After centrifugation the aqueous phase was transferred to a QIAGEN gDNA eliminator column and centrifuged at 10,000g for 1 minute at room temperature. The flow-through was mixed with an equal volume of 70% EtOH and transferred to an RNEasy mini spin column. The manufacturer protocol for the RNEasy Plus Mini Kit (QIAGEN) was followed for the rest of the procedure. cDNA was synthesized using the high Capacity cDNA reverse transcription (Applied Biosystems). qRT-PCR was performed using the SYBR Green intercalating dye (ThermoFisher Scientific). Expression was normalized to 18S ribosomal RNA and relative gene expression was calculated using 2−ΔΔCT method. Primers used for qRT-PCR are listed in Table S1.
Velazquez J.J., LeGraw R., Moghadam F., Tan Y., Kilbourne J., Maggiore J.C., Hislop J., Liu S., Cats D., de Sousa Lopes S.M., Plaisier C., Cahan P., Kiani S, & Ebrahimkhani M.R. (2020). Gene Regulatory Network Analysis and Engineering Directs Development and Vascularization of Multilineage Human Liver Organoids. Cell systems, 12(1), 41-55.e11.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!