According to the manufacturer’s protocol, total RNA was isolated from BPHs using RNAiso Plus (TaKaRa, Dalian, China). The isolated total RNA (1 μg) was subjected to reverse transcription (RT) using Quant Reverse Transcriptase (TIANGEN, Beijing, China) in a 20 μL reaction, following the manufacturer’s instructions. The complete open reading frame (ORF) was obtained from the transcriptome sequences and validated using specific primers (see Supplementary Table S2 ). Subsequently, the PCR products were cloned into the PMD-19T vector (TaKaRa) and subjected to sequencing.
Quant reverse transcriptase
Manufactured by Tiangen Biotech
Sourced in China
Quant Reverse Transcriptase is a laboratory enzyme used for the conversion of single-stranded RNA into complementary DNA (cDNA) molecules. It facilitates the reverse transcription process, a fundamental technique in molecular biology and genetic research.
Automatically generated - may contain errors
Lab products found in correlation
Rnaiso plus, by Takara Bio (2 mentions)
Quantstudio 6 flex real time pcr system, by Thermo Fisher Scientific (2 mentions)
Pmd19 t vector, by Takara Bio (1 mentions)
Abi steponeplus rt pcr system, by Thermo Fisher Scientific (1 mentions)
Tb green premix ex taq 2 kit, by Takara Bio (1 mentions)
Applied biosystems 7900ht real time pcr system, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Faststart universal sybr green master rox, by Roche (1 mentions)
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Real master mix, by Roche (1 mentions)
Rnaprep pure kit, by Tiangen Biotech (1 mentions)
Lightcycler 480 2, by Roche (1 mentions)
Qtower 2, by Analytik Jena (1 mentions)
Superreal premix plus sybr green, by Tiangen Biotech (1 mentions)
Trizol, by Tiangen Biotech (1 mentions)
Single cell sequence specific amplification kit, by Vazyme (1 mentions)
Abi 7500 real time pcr, by Thermo Fisher Scientific (1 mentions)
Sybr green, by Roche (1 mentions)
Rnase free dnase, by Promega (1 mentions)
Bioanalyzer, by Agilent Technologies (1 mentions)
11 protocols using quant reverse transcriptase
1
Isolation and Cloning of BPH ORF
2
Quantitative RT-PCR Protocol for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primers for qRT-PCR were designed using Beacon Designer 7.0 software. Total RNA was isolated using the method described above, and reverse-transcribed to cDNA using Quant reverse transcriptase (Tiangen, Biotech Co., Ltd., China), as per the manufacturer’s instructions. The qPCR was performed on the ABI Step-One-Plus RT-PCR system (ABI 7500, Applied Biosystems, Foster City, CA) using the TB Green Premix Ex Taq™ II Kit (TaKaRa Biotechnology Co., Ltd., Dalian, China). A 20 μL reaction was set; reaction solution contained 10 μL 2 × TB Green Premix Ex Taq II, 1.6 μL primer, 1 μL cDNA, 0.4 μL 50 × ROX, and 7.0 μL Rnase-free water. The RT-qPCR conditions were as follows: 95°C for 30 s, followed by 40 cycles of the amplification at 95°C for 5 s and 60°C for 34 s. All samples were evaluated in triplicates. Relative gene expression was normalized with the expression of the 16S rRNA gene and calculated using the 2–ΔΔCT method.
3
Quantitative RT-PCR Analysis of LASS2 mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.), and reverse transcribed into cDNA using Quant Reverse Transcriptase (Tiangen Biotech Co., Ltd., Beijing, China) following the manufacturer's protocol. β-Actin was used as the internal control. RT-qPCR was performed in a 20 µl reaction containing 1 µl cDNA template, 1 µl primer and 10 µl FastStart Universal SYBR Green Master (ROX) (Roche Ltd., Mannheim, Germany), using an Applied Biosystems 7900HT Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific Ltd., Waltham, MA, USA). The primers sequences were as follows: β-actin forward, 5′-GAAGGTGAAGGTCGGAGTC-3′; and reverse, 5′-GAAGATGGTGATGGGATTTC-3′; LASS2 forward, 5′-TCTCCTGGTTTGCCAATTACG-3′; and reverse, 5′-CCGGGCAGGGACCCTCATCA-3′. All the primers were synthesized by GeneCopoeia, Inc. The amplification program consisted of denaturation at 95°C for 1 min, followed by 40 cycles of denaturation at 95°C for 15 sec and annealing at 60°C for 30 sec, and then extension at 60°C for 30 sec. All experiments were repeated at least three times. The relative expression of LASS2 mRNA was calculated using the 2−ΔΔCq method (14 (link)).
4
Analyzing TNBC Gene and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA and small RNA were extracted from TNBC tumor tissues or cell lines, which were lysed and homogenized in TRIzol reagent, using a mirVana miRNA isolation kit based on the manufacturer’s instructions. First-strand cDNA was reverse transcribed from 1 μg small RNA by using the TaqMan microRNA reverse transcription kit (Thermo Fisher Scientific, Carlsbad, CA, USA) or from 1 μg total RNA by using Quant reverse transcriptase (Tiangen Biotech, Beijing, P.R. China) and oligo dT(20) primers. Then, qPCR was implemented on an Applied Biosystems QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher Scientific, Carlsbad, CA, USA). The relative mRNA expression of TNFAIP8 and TRAF2 was normalized to that of GAPDH (glyceraldehyde-3-phosphate dehydrogenase) mRNA, while the relative expression of miR-205-5p was normalized to U6 expression. All experiments were performed in triplicate. The primers used in qPCR are listed in Table 4 . The primers for miR-205-5p and endogenous control U6 were purchased from Ambion.
The Primers Used in Quantitative Real-Time PCR
| Primer Name | Sequence (5′–3′) |
|---|---|
| TNFAIP8 forward | ATAGACGACACAAGTAGTGAGGT |
| TNFAIP8 reverse | CCACGGTCATAGCAAGCTGAT |
| TRAF2 forward | GCTCATGCTGACCGAATGTC |
| TRAF2 reverse | GCCGTCACAAGTTAAGGGGAA |
| GAPDH forward | GGACACAATGGATTGCAAGG |
| GAPDH reverse | TAACCACTGCTCCACTCTGG |
5
Quantitative RT-PCR Analysis of E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Escherichia coli ZTK and its derivatives were harvested when grown to the exponential phase under anaerobic condition. Total RNA was extracted with RNAprep pure Kit (Tiangen, Beijing, China). 500 ng of total RNA was transcribed into cDNA using Quant Reverse Transcriptase with random primers (Tiangen, Beijing, China). Samples were then analyzed using a Light Cycler 480 II (Roche, Basel, Switzerland) with Real Master Mix (SYBR Green). The 16S rRNA gene was selected as reference for normalization and three biological replicates were performed. The obtained data were analyzed by using the 2−ΔΔCt method previously described [48 (link)].
6
Reverse Transcription and PCR Amplification of fruitless Splice Forms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from female (n = 10) and male (n = 15) BPH specimens. Following the manufacturer’s instructions, reverse transcription was performed using Quant Reverse Transcriptase (TIANGEN) in a 20 μL reaction volume. The cDNA was diluted 10-fold, and 1 μL was used as a template for subsequent PCR amplification. Gene-specific primers (see Supplementary Table S2 ) were used to amplify the specific splice forms of fruitless. The PCR conditions included an initial denaturation step at 94 °C for 5 min, followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s, and extension at 72 °C for 10 min.
7
Quantitative Real-Time PCR Protocol for Murine Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from selected mouse tissues using Trizol (Tiangen, Beijing, China) according to the manufacturer’s instructions and kept at –80°C before use. RNA samples (1600 ng) from mice were reverse transcribed into cDNA using Quant Reverse Transcriptase (Tiangen). SuperReal SYBR Green Premix Plus (Tiangen) was used for qPCR amplification. qPCR was performed on the qTOWER 2.2 (Analytik Jena AG, Jena, Germany). The reaction conditions were as follows: 95°C/ 15 min; 40 cycles of 95°C/ 15 s, X°C/ 20 s, 72°C/ 30 s; 95°C/ 15 s, 60°C/ 15 s. Murine β-actin was used as a reference to normalize the targeted gene expression levels. The sequences of specific primers are listed in
Table 1 .
Gene | Forward sequence (5′→3′) | Reverse sequence (5′→3′) |
β-actin | CCTGTATGCCTCTGGTCGTA | CCATCTCCTGCTCGAAGTCT |
MCP-1 | GGTCCCTGTCATGCTTCTG | GGGATCATCTTGCTGGTGAA |
IL-1β | GAAATGCCACCTTTTGACAGTG | TGGATGCTCTCATCAGGACAG |
IL-6 | ACAACCACGGCCTTCCCTACT | GCCATTGCACAACTCTTTTCTCAT |
TNF-α | CCTGTAGCCCACGTCGTAG | GGGAGTAGACAAGGTACAACCC |
iNOS | GTTCTCAGCCCAACAATACAAGA | GTGGACGGGTCGATGTCAC |
INF-γ | ATCTGGAGGAACTGGCAAAA | TGAGCTCATTGAATGCTTGG |
Collagen 1 | TAAGGGTCCCCAATGGTGAGA | GGGTCCCTCGACTCCTACAT |
TGF-β1 | CTTCAATACGTCAGACATTCGGG | GTAACGCCAGGAATTGTTGCTA |
8
Developmental RNA Extraction and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from embryos, first-, second-, third-, fourth-, fifth-instar nymphs, and female and male adults, respectively; 1 μg of RNA was used to perform reverse transcription in 20-μl reactions using Quant reverse transcriptase (TIANGEN, Beijing, China) according to the manufacturer’s instructions, diluted 10 times; and 1 μl was used in subsequent PCRs. The total RNA of individual eggs at different embryonic stages was extracted using RNAiso Plus (TaKaRa), and then 30 ng of RNA was used to perform reverse transcription in 5 μl using the Single Cell Sequence Specific Amplification Kit (Vazyme, NanJing, China); the assay pool used in this kit consisted of Nlfmd-F/C, qPCR-Nl18s, and Nldsx-F primers, and the concentration of each primer was 0.1 μM.
9
Lymphocyte mRNA Expression of MCP-1 and p65
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The relative expression of MCP-1 and p65 in lymphocytes were investigated through RT-qPCR. The mRNAs in cell lysates of lymphocytes were reverse transcribed into first line cDNA using Quant Reverse Transcriptase (Tiangen biotech, Beijing, China). The cDNAs then processed quantitative PCR using Fast-Fire qPCR PreMix (Probe; Tiangen) in ABI7500 Real-time PCR (Thermo fisher scientific) system. The expression of β-actin was determined as internal control. Primers were designed for the qRT-PCR (Table 1 ). The relative expression of these mRNAs was normalized to the expressions in control group. All of the experiments were triplicated.
10
Quantifying SOCS3 Expression in Pancreatic Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total mRNA was extracted from pancreatic cancer cell lines using TRIzol reagent. Then, CDNA was synthesized from 1 μg of total RNA using oligo dT and Quant Reverse Transcriptase (Tiangen, China). Real-time quantitative PCR was then conducted using SYBR Green (Roche) according to the manufacturer’s instructions. The primers used for SOCS3 and β-ACTIN are listed in Table 1 . PCR conditions were as follows: 94°C for 30 s, 60°C for 30 s and 72°C for 90 s, for 30 cycles, and a final extension at 72°C for 5 min. Relative expression levels of the genes were calculated using the 2-ΔΔCT method.
PCR primers
| Gene | Sequence (5′-3′) | Experimental use |
|---|---|---|
| SOCS3 | CAGCTCCAAGAGCGAGTACCA (forward) | Real-time PCR |
| AGAAGCCGCTCTCCTGCAG (reverse) | ||
| β-ACTIN | GCACCACACCTTCTACAATGAGC (forward) | Real-time PCR |
| TAGCACAGCCTGGATAGCAACG (reverse) | ||
| SOCS3(M) | TGATTAAATATTATAAGAAGGTCGGTCG (forward) | Methylation-specific PCR |
| ACTAACTACGTACGAAACCGAAACG (reverse) | ||
| SOCS3(U) | GTAGTGATTAAATATTATAAGAAGGTTGGTTG (forward) | Methylation-specific PCR |
| CTAACTACATACAAAACCAAAACAA (reverse) | ||
| SOCS3 siRNA-1 | CCAAGAACCUGCGCAUCCAdTdT | RNA interference |
| SOCS3 siRNA-2 | GGACCAAGAACCUACGCAUdTdT | RNA interference |
| SOCS3 siRNA-3 | CCAAGAGAGCUUACUACAUdTdT | RNA interference |
| SOCS3 siRNA-NC | UUCUCCGAACGUGUCACGUTT | RNA interference |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!