LATS kinase activity was monitored by LATS-BS consisting of two vectors: NLuc-YAP15 (#107610, Addgene) and 14-3-3-CLuc (#107611, Addgene)15 (link). Lenvatinib-resistant PLC/PRF/5 and Huh7 were transfected with LATS-BS and pRL-CMV Renilla luciferase (Promega) for normalization of transfection efficiency using Lipofectamine 2000. Treatment of 10 µM U0126 or solvent control (DMSO) for 4 hours was done at 48 hour post transfection. The cells were collected and luciferase signal was measured using Dual-luciferase report assay system (#E1910, Promega). Luciferase fold change was calculated according to the method described15 (link).
Prl cmv renilla luciferase
Manufactured by Promega
Sourced in United States, Canada
The PRL-CMV Renilla luciferase is a lab equipment product that measures the activity of the Renilla luciferase reporter gene. The Renilla luciferase is a bioluminescent protein that emits light upon the oxidation of its substrate, coelenterazine. This product can be used to quantify gene expression levels in various experimental systems.
Automatically generated - may contain errors
Lab products found in correlation
Dual luciferase reporter assay system, by Promega (3 mentions)
Pgl3 control vector, by Promega (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Lt1 transfection reagent, by Mirus Bio (2 mentions)
Dual luciferase assay system, by Promega (2 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Dual luciferase report assay system, by Promega (1 mentions)
14 3 3 cluc, by Addgene (1 mentions)
Dual luciferase assay kit, by Promega (1 mentions)
Flexstation 3, by Molecular Devices (1 mentions)
Minimal promoter, by Promega (1 mentions)
Lipofectamine plus reagent, by Thermo Fisher Scientific (1 mentions)
Td 20 20 luminometer, by Promega (1 mentions)
Dual luciferase reporter assay, by Promega (1 mentions)
Tnf α, by R&D Systems (1 mentions)
Fopflash, by Promega (1 mentions)
12 protocols using prl cmv renilla luciferase
1
LATS Kinase Activity Monitoring
2
Antioxidant Response Element Activation Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Differentiated CIHP-1 WT and REDD1 KO cells were cotransfected with the pRL-CMV Renilla luciferase (Promega) and antioxidant response element (ARE)-firefly luciferase (kindly provided by Dr. Jiyang Cai, University of Texas Medical Branch) plasmids combined in a 10:1 ratio using jetPRIME (Polyplus transfection). After 24 h, transfection media were removed, and cells were exposed to hyperglycemic conditions for 48 h. Luciferase activity was measured on a FlexStation 3 (Molecular Devices) with a Dual-Luciferase Assay Kit (Promega).
3
Plasmid Gifts for Cell Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
WT and kinase-defective TAK1 (K63W) plasmids were gifts from Dr Jun Ninomiya-Tsuji37 (link). pCX-EGFP construct was a gift from Dr Andras Nagy45 (link). FLAG-JUNWT-Myc and FLAG-JUN4A-MYC were gifts from Dr Axel Behrens (Addgene # 47443, 47444)30 (link). FOS-DD was a gift from Dr John Blenis (Addgene # 8698)31 (link). 3 × AP1-pGL3 was a gift from Dr Alexander Dent (Addgene # 40342)27 (link). pGL3Basic-962 CCND1 promoter luciferase), pGL3Basic-962 CCND1 promoter AP-1 site mutant (Addgene #32727 and # 32728) were gifts from Dr Frank McCormick28 (link). pRL-CMV (Renilla-Luciferase) was obtained from Promega. Adenoviral vectors (Ad-Cre and Ad-GFP) transduction was performed as described previously with a multiplicity of infection (MOI) of 500 for 40 h under serum-free conditions7 (link).
4
Dual Luciferase Reporters for GR and NF-κB
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Firefly Luciferase glucocorticoid-responsive reporters TAT-Luciferase (Luc) and MMTV-Luc, and NF-κB reporter × 3 κB-Luc were described previously.28 (link) The transfection efficacy was normalized using co-transfections with pRL-CMV-Renilla luciferase (RL) under minimal promoter (Promega, Madison, WI, USA). 3PC cells were transfected in 24-well plates (at least three wells/experimental group) using Plus Lipofectamine reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol. Each well contained 0.33 μg of the plasmid DNA. Twenty four hours after transfection, cells were treated with vehicle (0.01% acetone), CpdA (10−6−10–5 M) or FA (10−6 M) for 24 hours. To activate NF-κB, we used TNF-α (10 ng/mL; R D Systems, Minneapolis, MN, USA). Cells were treated with TNF-α and GR ligands simultaneously for 24 hours. The Firefly and RL activity was measured using TD20/20 Luminometer (Turner Biosystems, Sunnyvale, CA, USA) following the protocol for Dual Luciferase reporter assay (Promega).
5
Plasmids and siRNAs for Wnt Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following plasmids were used in this study: pCMV-Myc (control vector) (Clontech), TOPFLASH (Korinek et al., 1997 ), FOPFLASH (Korinek et al., 1997 ), pRL-CMV (Renilla Luciferase) (Promega), pcDNA-Wnt3A a gift from Cara Gottardi (Feinberg School of Medicine, Northwestern University). The following siRNA oligonucleotides were used in this study: PPP1R16A (MYPT3): ID s39809 (ThermoFisher Scientific), PPP1CB (PP1β): ID s10935 (ThermoFisher Scientific), siRNA Negative control #1 (Scramble) (ThermoFisher Scientific).
6
WNT-β-catenin and AP1 Signaling Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The WNT-β-catenin activity luciferase reporter vectors TOP_FLASH and FOP_FLASH and the fusion construct expressing LEF1-β-catenin were generous gifts of Prof. Tatiana Petrova. 48 The reporter for AP1 signalling, pGL3-5xTRE-TATA was used to measure the AP1 signalling pathway. The pRL CMV Renilla luciferase (Promega AG) plasmid was used to normalize for transfection efficiency. The two WIF1 expression vectors (pcDNA3.1_WIF1 and pIRES2_EGFP_WIF1) were described in Lambiv et al. 10 The list of siRNAs is available in Supplementary Table 1.
7
Luciferase Assay of 3'UTR Regulatory Regions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In brief, the 3′ untranslated region (UTR) including miRNA target sites of the Mdm2, E2f3, Ctnnbip1 and Ereg genes were amplified by PCR from mouse genomic DNA in accordance with previous reports19 , 20 , 21 and TargetScan (http://www.targetscan.org ). The luciferase constructs were made by ligating the 3′ UTR of the Mdm2, E2f3, Ctnnbip1 and Ereg genes into the Xba I site of the pGL3‐control vector (Promega, Madison, WI, USA). NIH3T3 cells were cultured in DMEM medium supplemented with 10% FBS. The cells were then transfected with the firefly luciferase reporter vector containing the 3′ UTR of the Mdm2, E2f3, Ctnnbip1 and Ereg genes and the control vector containing Renilla luciferase pRL‐CMV (Promega) using lipofectamine 3000 (Thermo Fisher Scientific) in six‐well plates. The luciferase assays were performed 24 h after transfection using the Dual Luciferase Reporter Assay System (Promega). The activity of firefly luciferase was normalized to that of Renilla luciferase.
8
miR-27b Transfection in PASMCS Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RPMI1640 medium with 10% fetal bovine serum was used to incubate PASMCS cells. lipofectamine 2000 (Invitrogen, Carlsbad, CA) was used to transfected miR-27b into PASMCS cells in 24-well plates at a final concentration of 100 nM per well, about 0.4 mg of firefly luciferase reporter vector including the mutant target site, and wild-type and 0.02 mg of the control plasmid including Renilla luciferase pRL-CMV (Promega). The Dual Luciferase Reporter Assay System (Promega) was used to analyze the luciferase assays 12 h after transfection. All experiments were performed at least 3 times.
9
3'UTR-Mediated Regulation of Key Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The wild type and mutated 3′UTR of DVL-1, c-Myb, GR and Bim were ordered from Syntezza Bioscience IDT company into PUC57 vector. 3′UTRs were excised from PUC57 vector using XBA1 restriction sites and then cloned into a Firefly luciferase reporter PGL3 vector. The inserts and their proper orientation were confirmed by sequencing. For the right orientation we used the following primer: GAGTTGTGTTTGTGGACGAA. For validating the correct sequence of both wild type and mutated 3′UTRs, we used the following primers: c-Myb: CCATGTGACATTTAATCCAGATTG, BIM: first site-GAGTTGTGTTTGTGGACGAA and second site- ATCCCTGCTGATTTAGCC, GR: TACACATCCCTAAT GTGTGC. 293T cells were plated in 24-well plates and 24 hrs later were transfected with 200 ng of a Firefly luciferase reporter vector and 50 ng of the control Renilla luciferase pRL-CMV (Promega) using the LT1 transfection reagent (Mirus). Firefly and Renilla luciferase activities were measured consecutively with the Dual-Luciferase Assay System (Promega), 48 hrs following transfection. Firefly luciferase activity was normalized to Renilla luciferase activity and then normalized to the average activity of the control reporter.
10
TWIST1 3'UTR Regulation by miR-520d-5p
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 3′UTR of TWIST1 was cloned from cDNA extracted from HeLa and JEG 3 cells. The primers for cloning the 3′UTR are: FW GGTCTAGAGCAGGCGGAGCCCCCCAC REV GGTCTAGACTCTAAATTTTTTATATTTATTTATTGC. The inserts and their proper orientation were confirmed by sequencing. For the TWIST1 mutation (miR-520d-5p site), following primers were used: FW 5′ TGTAAATATCTTACAATATTTTTC, REV5′ GAAAAATATTGTAAGATATTTACA. DU 145/HeLa/MDA-MB-231 cells were plated in 24-well plates and 24 h later were transfected with 100 ng of a Firefly luciferase reporter vector and 50 ng of the control Renilla luciferase pRL-CMV (Promega) using the LT1 transfection reagent (Mirus), at a final volume of 0.5 ml. Firefly and Renilla luciferase activities were measured consecutively with the Dual-Luciferase Assay System (Promega), 48 h following transfection. Firefly luciferase activity was normalized to Renilla luciferase activity and then normalized to the average activity of the control reporter.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!