E. coli IscR-C92A protein that lacks the [2Fe-2S] cluster was isolated as previously described [25 (link), 30 (link)] and subsequently used in electrophoretic mobility shift assays (EMSAs) because this apo- form of IscR binds exclusively to type II sites. DNA fragments containing the wild-type Y. pseudotuberculosis lcrF promoter (-206 to +12 bp relative to the +1 transcription start site), or its lcrFpNull variant in which the IscR binding site is disrupted, were isolated from pPK12778 and pPK12779, respectively, after digestion with HindIII and BamHI, and EMSAs were carried out with purified IscR-C92A as previously described [29 (link)]. Cut vector backbone is also present in the reaction and serves as a source of nonspecific DNA. After incubation at 37°C for 30 min, samples were loaded onto a non-denaturing 6% polyacrylamide gel in 0.5× Tris-borate-EDTA buffer and run at 100 V for 4.0 hrs at room temperature. The gel was stained with SYBR Green EMSA nucleic acid gel stain (Molecular Probes) and visualized using a Typhoon FLA 900 imager (GE).
Typhoon fla 900 imager
Manufactured by GE Healthcare
The Typhoon FLA 900 imager is a versatile fluorescence detection system designed for various imaging applications in life science research. It utilizes a high-sensitivity laser-based detection technology to capture high-resolution images of fluorescently labeled samples such as gels, blots, and microarrays.
Automatically generated - may contain errors
3 protocols using typhoon fla 900 imager
1
IscR-C92A Protein Binding Assay
2
Pulse-Chase RNA Turnover Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were starved in phosphate-free DMEM (Invitrogen, cat. no. 11971–02) supplemented with 10% dialyzed FCS for 1 h at 37°C and subsequently pulse-labeled in phosphate-free DMEM containing 33P phosphoric acid (20 μC/ml) for 1 h at 37°C. Cells were briefly washed in DMEM −/− and kept in non-radioactive DMEM +/+ until harvest after a chase period of 240 min. Total RNA was extracted using the RNeasy mini kit (Qiagen) and 800 ng total RNA were separated on a 1.2% agarose-formaldehyde gel in 50 mM HEPES pH 7.8, 1 mM EDTA (75 V, 3.5 h). RNA was stained with GelRed (Biotium, cat. no. 41003). After washing the gel with 75 mM NaOH for 15 min, 0.5 M Tris pH 7.0, 1.5 M NaCl for 20 min and 10× SSC for 10 min, RNA was transferred onto a nylon membrane (Hybond-N+; GE Healthcare) by capillary transfer. The membrane was analyzed by phosphor-imaging using a Typhoon FLA 900 imager (GE Healthcare). Signals were then analyzed using the Fiji Software.
3
Northern Blot Analysis of rRNA Precursors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using the RNeasy mini kit (Qiagen). Northern blot analysis was performed as described previously (32 (link)). 1.5 μg of total RNA were separated on a 1.2% agarose–formaldehyde gel in 50 mM HEPES pH 7.8, 1 mM EDTA (75 V, 5 h). RNA was stained with GelRed (Biotium, cat. no. 41003). After washing the gel with 75 mM NaOH for 15 min, 0.5 M Tris pH 7.0, 1.5 M NaCl for 20 min and 10X SSC for 10 min, RNA was transferred onto a nylon membrane (Hybond-N+; GE Healthcare) by capillary transfer. After the RNA was UV crosslinked, the membrane was prehybridized in 50% (v/v) formamide, 5× SSPE, 5× Denhardt's solution, 1% SDS, 200 μg/ml DNA (Roche, cat#11467140001) for 1 h at 65°C. rRNA precursors were hybridized with radioactively (32P) labeled probes (5′ITS1: CCTCGCCCTCCGGGCTCCGTTAATGATC, ITS2 GCGCGACGGCGGACGACACCGCGGCGTC) (46 (link)) for 1 h at 65°C and subsequent overnight incubation at 42°C. After three washes for 5 min with 2× SSC at 37°C, the membrane was analyzed by phosphor-imaging using a Typhoon FLA 900 imager (GE Healthcare). Signals were then analyzed using the Fiji Software.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!