Inference of crispr edits

To knockout the KLF4 gene in MM6 and NB4 cells, we used 3 chemically modified synthetic sgRNAs from Synthego with sequences GCCATGTCAGACTCGCCAGG, CGCCGGGCCAGACGCGAACG, and GAGCGATACTCACGTTATTC and followed the instructions obtained from the manufacturer to form the RNP complex with Cas9 (Cas9 plus sgRNAs). Briefly, the Cas9-sgRNA RNP in a total volume of 12 μl were electroporated using the Neon transfection system (Thermo Fisher Scientific) under the following conditions: 1400V, 10 ms, 3 pulse. Electroporated cells were cultured in growth medium for 3 days and then single cell clones were obtained by diluting cells to 0.5 cells/100 μl and plating in 96-well U-bottom plate for 2 weeks. Genomic DNAs were isolated and then used for PCR amplification using forward primer GTGTTATGTCCTGTCTGCCCAATT and reverse primer GTTTTGGCTTCGTTTCTTCTCTTC, spanning the Cas9-sgRNA cleavage site. PCR amplicons were then used for sequencing analysis using sequencing primer (CTTACCCTCGTTCAGTGGCTCTT) to identify the knockout efficiency using Inference of CRISPR Edits (ICE) which is a free and open source software tool that offers fast and reliable analysis of CRISPR editing data from Synthego. Knockout was additionally verified by immunoblotting and PCR detection of cleaved genomic DNA on 2.0% agarose gel.

K562 cells containing deletions in the ALAS2 or FECH genes were created using a multi-guide strategy via nucleofection (Lonza) of Cas9/RNP complexes (Gene KO Kit v2; Synthego) following the manufacturer’s instructions. The guide RNAs used were as follows: ALAS2: UGAAGGCUUUCAAGACAGGU, CAAUCUUGCUCUUCCCAUCC, and AGAUUCUCCAUCUUGGGCGA; FECH: UUAGACUCAUACCUCUUCUG, CUGGGCUGUUUCUGUGGUGA, and CUGACAGACCCUCCAGCUGC. CRISPR/Cas9 deletions were confirmed after amplification of the genomic region of interest, Sanger sequencing of the amplified region, and Inference of CRISPR Edits analyses (Synthego). Cells were lysed in RIPA buffer with protease and phosphatase inhibitors and immunoblotted with antibodies that recognize FECH (SC-377377) and vinculin (SC-73614) (Santa Cruz Biotechnology). PCR amplification of the first-strand cDNA from K562 and K562-ALAS2 KO was used to confirm the presence of the homozygous 107-bp out-of-frame deletion that was detected in the Inference of CRISPR Edits analyses of the edited genomic region in K562-ALAS2 KO cells.