Phusion 2x hf master mix

For all samples, we started with 100–300 ng of double-stranded, fragmented DNA. We end-repaired and 5′-phosphorylated using the End Repair Module (New England Biolabs #E6050L), A-tailed with Klenow exo- (New England Biolabs #M0212S), and ligated to adapters (8.3 nM) with a Quick Ligase Kit (New England Biolabs #M2200S). We PCR-amplified using Phusion 2X HF master mix (New England Biolabs #M0531S) in a 50-μl total volume containing 200 nM of each primer. Thermocycler conditions were as follows: an initial denaturation at 98° for 30 sec; no more than 12 cycles of 98° for 30 sec, 65° for 30 sec, and 72° for 30 sec; and a final extension at 72° for 5 min. We purified DNA between each enzymatic treatment using Agencourt AMPure XP at a ratio of 1.8:1, except after PCR, where the ratio was 0.9:1. Prior to sequencing, we selected amplicons corresponding ∼150-bp inserts by gel electrophoresis on a 2.5% agarose gel and purified using a QIAquick gel extraction kit (Qiagen #28704). We used indexed PCR primers from the ScriptSeq Index PCR primers (Epicentre, #RSBC10948 and #SSIP1202) at a concentration of 200 nM. We used a Y adapter of the following two oligos at a concentration of 8.3 nM each: /5Phos/GATCGGAAGAGCACACGTCT and ACACTCTTTCCCTACACGACGCTCTTCCGATCT.