Superscript reverse transcriptase

Manufactured by Thermo Fisher Scientific

Sourced in United States, Germany, France, Canada, China, Switzerland

SuperScript reverse transcriptase is a thermostable enzyme used for the synthesis of complementary DNA (cDNA) from RNA templates. It catalyzes the conversion of single-stranded RNA into double-stranded cDNA, which can then be used for various downstream applications such as gene expression analysis and cDNA library construction.

Automatically generated - may contain errors

Lab products found in correlation

342 protocols using superscript reverse transcriptase

Viral RNA Extraction and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Viral RNA was extracted from 140 μL of plasma using the QIAamp Viral RNA Extraction Kit (QIAGEN), according to the manufacturer's protocol. Ten microliters of the extracted RNA was added to 300 ng of random oligonucleotides (2 μL of 150 ng/solution, N6, Life Technologies, Itapevi, Brazil) and denatured at 70°C for 10 minutes. For cDNA synthesis, 200 U of Superscript reverse transcriptase (Thermo Fisher Scientific, Pittsburgh, PA), 0.1 M DTT, 5 U of RNaseOUT® (Life Technologies, Forster City, CA), and 0.5 mM of each deoxynucleotide were added. The cDNA reaction was conducted at 42°C for 1.5h in a final volume of 20 μL.

Mota L.D., Finger-Jardim F., Silva C.M., Germano F.N., Nader M.M., Gonçalves C.V., Luquez K.Y., Chies J.A., Groll A.V., Hora V.P., Silveira J., Basso R.P., Soares M.A, & Martínez A.M. (2019). Molecular and Clinical Profiles of Human Pegivirus Type 1 Infection in Individuals Living with HIV-1 in the Extreme South of Brazil. BioMed Research International, 2019, 8048670.

+ Open protocol

+ Expand

Quantifying Gene Expression in 35S::ATML1-GR Plants

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The levels of gene expression in both Mock-treated and Dex-treated 35S::ATML1-GR plants were quantified through the real-time RT-PCR. 35S::ATML1-GR plants lines 5 and 9 were grown in short days for 20 days. After that, they were sprayed with mock (no Dex) or with 10 µM DEX solution. After 24 h, the whole shoots were cut off from the top of hypocotyls and harvested for RNA extraction and RNA was isolated using RNeasy Mini Kit (Qiagen). Reverse transcription was performed from 1.2 µg total RNA using SuperScript Reverse Transcriptase (ThermoFisher). Quantitative PCR was performed using SYBR Green qPCR Master Mix (Bimake) on a BioRad CFX96. The primers for UBC (as the internal control) qPCR are described previously^{7 (link)}. The primers for GFP are 5′-GAACCGCATCGAGCTGAA-3′ and 5′-TGCTTGTCGGCCATGATATAG-3′. The primers for MIR171A: 5′-GATATTGGCCTGGTTCACTC-3′ and 5′-CCACAAAGTCCAAAATAGAG-3′ and for MIR171B: 5′-GGAGCTAAGTGGAGATTATAG-3′ and 5′-GGTTATAATAACTATCTTTGCC-3′ as described previously^{13 (link)}. The primers of HAM1 and HAM2 qPCR were designed to span their miR171 targeting sites. For HAM1: 5′-AAACAACAACGGCGACCA-3′ and 5′-CTTTGAAACGGAGACTTGTGG-3′ were used. For HAM2: 5′-CAAACGGCGGAGATAACAAT-3′ and 5′-CTGTGGAACGGAGGTTTAGG-3′ were used. The mean and standard error was calculated from three independent biological replicates.

Han H., Yan A., Li L., Zhu Y., Feng B., Liu X, & Zhou Y. (2020). A signal cascade originated from epidermis defines apical-basal patterning of Arabidopsis shoot apical meristems. Nature Communications, 11, 1214.

+ Open protocol

+ Expand

Quantifying Interferon-alpha Induction in Dendritic Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

IL-4 DCs (2.5 x 10⁵ cells) were plated in 48-well plates and treated with 500 IU/ml of recombinant IFN-α for 18 h. Cells were washed twice in phosphate-buffered saline (PBS) and total RNA was extracted using the RNeasy minikit (Quiagen, 74106). Extracted RNA was treated with RQ1-RNAse-free DNAse (Promega). RNA concentration was determined with a NanoDropND1000 spectrophotometer (Thermo Scientific). RT-PCR was performed on 500 ng of RNA using the SuperScript Reverse Transcriptase (Thermofisher). cDNA concentration was then determined with a NanoDropND1000 spectrophotometer (Thermo Scientific). cDNA amplification was performed on 200 ng of cDNA using the GoTaq polymerase (Promega) and Mx1 primers as previously described [23 (link)]. PCR products were analyzed by electrophoresis on a 2% agarose gel.

Rizkallah G., Alais S., Futsch N., Tanaka Y., Journo C., Mahieux R, & Dutartre H. (2017). Dendritic cell maturation, but not type I interferon exposure, restricts infection by HTLV-1, and viral transmission to T-cells. PLoS Pathogens, 13(4), e1006353.

+ Open protocol

+ Expand

Quantifying Viral Titers in Tissues

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

MCMV viral titers were determined as previously described (Kamimura and Lanier, 2014 (link)). DNA was isolated from peripheral blood, PC, or Liver; using a genomic purification kit (QIAGEN). Following isolation, DNA concentration was measured using Nanodrop for each sample, and 3 µL was added into mastermix containing iQ Sybr Green (Bio-Rad) and primers specific to MCMV IE-1 DNA (F: TCGCCCATCGTTTCGAGA, R: TCTCGTAGGTCCACTGACCGA). Copy number was determined by comparing Cq values to a standard curve of known dilutions of an MCMV plasmid and normalized relative to total DNA content. Liver and PC viral titers were normalized to weight of organ and volume of peritoneal gavage respectively.
SeV viral particles were determined by qRT-PCR as previously described (Hermesh et al., 2010 (link)). Lungs were harvested after infection and homogenized in 2 ml TRIzol reagent (Thermo Fisher). RNA was isolated from TRIzol according to the manufacturer’s protocol. cDNA was synthesized using Superscript Reverse Transcriptase (Thermo Fisher) and quantitative PCR was performed using SYBR-Green (Bio-Rad) on a CFX Connect instrument (Bio-Rad). SeV RNA was detected using primers designed to SEV P (F: CCAAGAGAGCGTGGAATCAT R: GGGTCAAACCTGGTAGCCTT)). SeV P RNA levels were normalized to β-actin (F: AGGTGACAGCATTGCTTCTG R: GCTGCCTCAACACCTCAAC) using the 2-ΔΔCT method.

Weizman O.E., Adams N.M., Schuster I., Krishna C., Pritykin Y., Lau C., Degli-Esposti M.A., Leslie C.S., Sun J.C, & O’Sullivan T.E. (2017). ILC1 confer early host protection at initial sites of viral infection. Cell, 171(4), 795-808.e12.

+ Open protocol

+ Expand

Quantitative Analysis of mRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the analysis of the mRNA expression, the total RNA was isolated using RNA-Solv® Reagent (Omega Bio-tek, Norcross, GA, USA) following the manufacturer’s instructions and reverse-transcribed with SuperScript reverse transcriptase, oligo(dT) primers (Thermo Fisher Scientific), and deoxynucleoside triphosphates (Promega, Mannheim, Germany). Real-time PCR was performed in duplicates in a total volume of 20 µL using Power SYBR green PCR Master Mix (Thermo Fisher Scientific) on a Step One Plus Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) in 96-well PCR plates (Applied Biosystems). The SYBR Green fluorescence emissions were monitored after each cycle. For normalization, the expression of glyceraldehyde 3-phosphate dehydrogenase as housekeeper was determined in duplicates. The gene expression was calculated using the 2^{− ΔΔCt} method. The PCR primers were obtained from Microsynth AG (Balgach, Switzerland) and are available upon request.

Troidl K., Schubert C., Vlacil A.K., Chennupati R., Koch S., Schütt J., Oberoi R., Schaper W., Schmitz-Rixen T., Schieffer B, & Grote K. (2020). The Lipopeptide MALP-2 Promotes Collateral Growth. Cells, 9(4), 997.

+ Open protocol

+ Expand

Muscle-Specific Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from flash frozen EDL and gastrocnemius muscle using the RNeasy kit (Qiagen) according to the manufacturer’s protocol. Total RNA was reverse transcribed using random oligo-dT primers and Superscript Reverse Transcriptase (Thermo Fisher Scientific).
qPCR was performed using SsoAdvanced SYBR Green (Bio-Rad, 6090), and GAPDH expression was used for normalization. All experiments were performed in duplicate. The following primer sets were used to identify transcripts: Atp2a2, 5′-GAGAACGCTCACACAAAGACC, 5′-CAATTCGTTGGAGCCCCAT; Myh7, 5′-ACTGTCAACACTAAGAGGGTCA, 5′-TTGGATGATTTGATCTTCCAGGG; Tnnc1, 5′-GCGGTAGAACAGTTGACAGAG, 5′-CCAGCTCCTTGGTGCTGAT; Tnni1, 5′-ATGCCGGAAGTTGAGAGGAAA, 5′-TCCGAGAGGTAACGCACCTT; Tnnt1, 5′-CCTGTGGTGCCTCCTTTGATT, 5′-TGCGGTCTTTTAGTGCAATGAG. GAPDH was used as an internal control 5′-TGACCACAGTCCATGCCATC and 5′-GACGGACACATTGGGGGTAG. Statistical analyses were performed using data generated by calculating the ΔCt (the difference in the Ct value between the gene of interest and the GAPDH Ct value). Fold changes were calculated using the ΔΔCt method and the fold-change ranges were calculated using error propagation.

Boyer J.G., Prasad V., Song T., Lee D., Fu X., Grimes K.M., Sargent M.A., Sadayappan S, & Molkentin J.D. (2019). ERK1/2 signaling induces skeletal muscle slow fiber-type switching and reduces muscular dystrophy disease severity. JCI Insight, 4(10), e127356.

+ Open protocol

+ Expand

Quantitative Real-Time PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA was extracted using the RNeasy Mini Kit (Qiagen Cat No./ID: 74,104) according to the instructions provided. The synthesis of the first-strand cDNA was performed using SuperScript Reverse Transcriptase (Thermo Scientific) according to the manufacturer’s instructions. Quantitative real-time PCR was done using SYBR™ Green PCR Master Mix (Thermo scientific Cat number: 4309155) by the ABI Prism Step One Plus Real-Time PCR System (Applied Biosystems). The assay was performed in duplicates and the ACTB was used as the internal standard for the calculation of the expression level. The primer sets of the studied genes were shown in Table 1 and the fold change was calculated using 2^−˄˄CT.Table 1

The primer sets of the studied genes

	Sense	Antisense	Amplicon	Accession no
Caspase 3	GAGCTTGGAACGCGAAGAAA	TTGCGAGCTGACATTCCAGT	221	NM_012922.2
JNK	GTCATTCTCGGCATGGGCTA	TGGACGCATCTATCACCAGC	337	NM_053829.2
HO-1	AGCGAAACAAGCAGAACCCA	ACCTCGTGGAGACGCTTTAC	166	NM_012580.2
Keap-1	ATGTGATGAACGGGGCAGTC	AAGAACTCCTCCTCCCCGAA	190	NM_057152.2
ACTB	CCGCGAGTACAACCTTCTTG	CAGTTGGTGACAATGCCGTG	297	NM_031144.3

JNK, c-Jun N-terminal kinases; HO-1, Heme oxygenase; Keap-1, Kelch Like ECH Associated Protein 1; ACTB, Beta actin (housekeeping gene)

Hassanen E.I., Hussien A.M., Mehanna S., Ibrahim M.A, & Hassan N.H. (2022). Comparative assessment on the probable mechanisms underlying the hepatorenal toxicity of commercial imidacloprid and hexaflumuron formulations in rats. Environmental Science and Pollution Research International, 29(19), 29091-29104.

+ Open protocol

+ Expand

Real-Time qPCR Analysis of HMOX1 and NQO1

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using the RNeasy Mini Kit (Qiagen, Hilden, Germany). Total RNA was reverse‐transcribed to cDNA using SuperScript Reverse Transcriptase (Thermo Fisher Scientific). Real‐time quantitative PCR was performed with Mx3000P (Stratagene, CA, USA). The following cycle parameters were used: denaturation at 95°C for 10 seconds, annealing for 30 seconds at 60°C, and elongation for 30 seconds at 72°C. Sequences of sense and antisense primers used were as follows13, 14: HMOX1 sense, 5′‐CCAGCAACAAAGTGCAAGATTC‐3′; HMOX1 antisense, 5′‐TCACATGGCATAAAGCCCTACAG‐3′; NQO1 sense, 5′‐GAAGAGCACTGATC GTACTGGC‐3′; NQO1 antisense, 5′‐GGATACTGAAAGTTCGCAGGG‐3′; actin sense, 5′‐AGAGCTACGAGCTGCCTGAC‐3′; actin antisense, 5′‐AGCACTGTGTTGGCGTACAG‐3′.

Vu H.T., Kobayashi M., Hegazy A.M., Tadokoro Y., Ueno M., Kasahara A., Takase Y., Nomura N., Peng H., Ito C., Ino Y., Todo T., Nakada M, & Hirao A. (2018). Autophagy inhibition synergizes with calcium mobilization to achieve efficient therapy of malignant gliomas. Cancer Science, 109(8), 2497-2508.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using an RNeasy Mini kit (Qiagen, Germany) and purified using RNeasy columns. The integrity of the RNA was determined using an Agilent 2100 Bioanalyzer. For qRT-PCR, the total RNA from cells was used to synthesize cDNA by extension of oligo (dT)₁₅ primers with SuperScript reverse transcriptase (Thermo Fisher Scientific, USA). Real-time PCR experiments were performed in duplicates using a cDNA equivalent of 22.5 ng RNA in a 10 μL reaction volume containing 2x SYBR Green Fast PCR Master Mix (Applied Biosystems, Foster City, CA, USA) and a set of primers. Sequences of the primers are listed in Table S1. Data were analyzed by the relative quantification method using StepOne Software (Applied Biosystems, Foster City, CA, USA). The expression of each product was normalized to 18S rRNA and presented as a dCt value.

Ciechomska I.A., Wojnicki K., Wojtas B., Szadkowska P., Poleszak K., Kaza B., Jaskula K., Dawidczyk W., Czepko R., Banach M., Czapski B., Nauman P., Kotulska K., Grajkowska W., Roszkowski M., Czernicki T., Marchel A, & Kaminska B. (2023). Exploring Novel Therapeutic Opportunities for Glioblastoma Using Patient-Derived Cell Cultures. Cancers, 15(5), 1562.

+ Open protocol

+ Expand

Quantitative real-time PCR for gene expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cytoplasmic RNA was prepared using TRIzol reagent (Thermo Fisher Scientific, Carlsbad, CS, USA), aliquots converted to cDNA using random hexamer primers and SuperScript^® Reverse transcriptase (Thermo Fisher Scientific), and mRNA levels estimated by quantitative real-time PCR (QPCR). PCR conditions were 35 cycles at 95 °C for 10 s, annealing at 60 °C for 15 s, and extension at 72 °C for 30 s followed by 5 min at 72 °C in a Corbett Rotorgene. Reactions were carried out in the presence of Sybr Green (Biotools). Relative mRNA levels were calculated by comparison of take-off cycles and normalized to values for GAPDH measured in the same sample. The following primers were used (forward/reverse, 5′ to 3′):
Mouse FPR2:CTGGGCTCAAACTGATGAAGA/CGTAAAGGACGGCTGGAATTAMouse 15-LOX:GGGACAATGGACACCGTTATTA/CCAGGTACTGCTGACTACAAAG Mouse 5-LOX:TCAAGCAGCACAGACGTAAA/GCCATCCAGTAGCTCGTAATCRat 15-LOX:CTCCACTACAAGACCGACAAAG/GTGCATTAGGAACCCAGTAGAARat 5-LOX:CTGGTAGCCCATGTGAGGTT/GCACAGGGAGGAATAGGTCARat GPR32:CCTTTCTGGTTCTCACCTTCTT/GTGATGGCCTGTCTCTCTTTCRat FPR2:CGCTGTCAAGATCCACAGAA/CTCCAAACTGGAAGGCAGAGRat IL-1β:ACCTGCTAGTGTGTGATGTTCCCA/AGGTGGAGAGCTTTCAGCTCACATRatMIP-1α:CAGAACATTCCTGCCACCTGCAAA/AGGAATGTGCCCTGAGGTCTT TCARat TNFα:CTGGCCAATGGCATGGATCTCAAA/AGCCTTGTCCCTTGAAGAGAA CCTRat NOS2:AGCACATTTGGCAATGGAGACTGC/AGCAAAGGCACAGAACTGAGG GTARat/mouse GAPDH:TGCACCACCAACTGCTTAGA/GGCATGGACTGTGGTCATGAG

Gutiérrez I.L., Novellino F., Caso J.R., García-Bueno B., Leza J.C, & Madrigal J.L. (2022). CCL2 Inhibition of Pro-Resolving Mediators Potentiates Neuroinflammation in Astrocytes. International Journal of Molecular Sciences, 23(6), 3307.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!