Dreamtaq buffer

Manufactured by Thermo Fisher Scientific

Sourced in United States, Germany, Lithuania

DreamTaq Buffer is a 10x concentrated buffer solution designed for use with the DreamTaq DNA Polymerase, a thermostable DNA polymerase. The buffer provides optimal reaction conditions for DNA amplification in PCR applications.

Automatically generated - may contain errors

Lab products found in correlation

83 protocols using dreamtaq buffer

Microsatellite Genotyping of Plant Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was extracted following the method described by Doyle and Doyle [31 ]. DNA quantification was performed by NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA) and integrity was checked on 1% agarose gel.
Nineteen microsatellite (SSR) markers (Table 2) were selected according to their informative content from Soriano et al. [15 (link)]. SSR amplifications were performed in a final volumen of 20 µL containing 1× DreamTaq buffer, 0.2 mM of each dNTP, 20 ng of genomic DNA and 1 U of DreamTaq DNA polymerase (Thermo Fisher Scientific, Waltham, MA, USA) using a UNO96 thermal cycler (VWR, Radnor, PA, USA). Each reaction was performed in 20 µL with three primers: the specific forward primer of each microsatellite with an M13(−21) tail at its 5′ end (0.05 µM), the sequence-specific reverse primer (0.25 µM) and the universal fluorescent-labeled M13(−21) primer (0.2 µM) [32 (link)]. The PCR temperature cycling conditions were as follows: 94 °C for 2 min, then 35 cycles of 94 °C for 30 s, the optimized annealing temperature (Table 2) for 60 s and 72 °C for 90 s, finishing with 72 °C for 10 min. Allele lengths were determined using an ABI Prism 3130 Genetic Analyzer with the aid of GeneMapper software, version 4.0 (Applied Biosystems, Waltham, MA, USA).

Zuriaga E., Pintová J., Bartual J, & Badenes M.L. (2022). Characterization of the Spanish Pomegranate Germplasm Collection Maintained at the Agricultural Experiment Station of Elche to Identify Promising Breeding Materials. Plants, 11(9), 1257.

+ Open protocol

+ Expand

Analyzing Wnt Signaling in DP Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from DP cells using TRIzol™ Reagent (Invitrogen; Thermo Fisher Scientific), and cDNA was synthesized using reverse transcription kit (Applied Biosystems; Thermo Fisher Scientific). For real-time PCR, QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific) was used. Total reaction volume of 20 μL contained 1-μL cDNA, 500 nM of each primer, and 10-μL SensiFAST™ SYBR Lo-ROX Kit (Bioline, Taunton, MA, USA). Samples were analyzed in triplicate, and β-actin was used as an internal control to normalize the relative quantity of gene expression. For PCR, total volume of 50 μL contained 1-μL cDNA, 200 nM of each primer, Dream Taq DNA Polymerase and Dream Taq buffer (Thermo Fisher Scientific) for 35 cycles. The following primer pairs were used: Wnt3a, 5′-AGTGCAAATGCCACGGACTA-3′ (forward), 5′-TTGGGCTCGCAGAAGTTAGG-3′ (reverse); Wnt7a, 5′-CAGAATGCCCGAACCCTCAT-3′ (forward), 5′-TAGCCT GAGGGGCTGTCTTA-3′ (reverse); β-catenin, 5′-CCATCACCACGCTGCATAAT-3′ (forward), 5′-GAGCAGACAGACAGCACCTT-3′ (reverse); Lef1, 5′-GGCATC CCTCATCCAGCAAT-3′ (forward), 5′-GTTGATAGCTGCGCTCTCCT-3′ (reverse); Gsk3b, 5′-AGAACCACCTCCTTTGCGGA-3′ (forward), 5′-GTGGTTACCTTGCTGCCATCT-3′ (reverse); Fzd7, 5′-GGTGGATGGTGACCTACTCA-3′ (forward), 5′-GCTCGTAAAAGTAGCACGCC-3′ (reverse); and β-actin, 5′-AAGATCCTGACCGA GCGTGG-3′ (forward), 5′-CCGCTCATTGCCGATAGTG-3′ (reverse).

Huang H.C., Lin H, & Huang M.C. (2019). Lactoferrin promotes hair growth in mice and increases dermal papilla cell proliferation through Erk/Akt and Wnt signaling pathways. Archives of Dermatological Research, 311(5), 411-420.

+ Open protocol

+ Expand

PCR Genotyping for Sgcd Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

We prepared a PCR mix (10 µL) using a final concentration of 0.2 mM dNTPs (Thermo Fisher Scientific Inc., Wilmington, DE, USA), 0.08× of each primer, 0.5 U/µL DreamTaq DNA polymerase, and 1× DreamTaq Buffer (Thermo Fisher Scientific Inc., Wilmington, DE, USA). One microliter (~150 ng of DNA) was added to the PCR mix. The amplification conditions were: 30 s at 95 °C (melting), 30 s at 67 °C (annealing), and 60 s at 72 °C (extension) for 35 cycles. Amplicons were run on a 2% agarose gel stained with 0.5 µg/mL ethidium bromide, and were compared to the GeneRuler 100 base pairs (bp) DNA ladder (Thermo Fisher Scientific Inc., Wilmington, DE, USA). Per primer design [5′ GCTTTCCCTGCTCCTGGTTCATTT 3′ (sense), 5′ TTCCCACTTCTTGACCCTGTCGTT 3′ (antisense) and 5′ ACCTTGCTCCTGCCGAGAAAGTAT 3′ (neomycin cassette)], our amplicons of 700 bp corresponded to an Sgcd^+/+ mouse and 1014 bp for the neomycin cassette corresponded to an Sgcd^−/− mouse.

Perez-Ortiz A.C., Peralta-Ildefonso M.J., Lira-Romero E., Moya-Albor E., Brieva J., Ramirez-Sanchez I., Clapp C., Luna-Angulo A., Rendon A., Adan-Castro E., Ramírez-Hernández G., Díaz-Lezama N., Coral-Vázquez R.M, & Estrada-Mena F.J. (2019). Lack of Delta-Sarcoglycan (Sgcd) Results in Retinal Degeneration. International Journal of Molecular Sciences, 20(21), 5480.

+ Open protocol

+ Expand

Amplification and Identification of Genomic DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Amplification was carried out by conventional polymerase chain reaction (PCR) in 20 μl reactions containing 1× 10× DreamTaq Buffer (Thermo Fisher Scientific, USA) 0.5 μM of each primer (Table 1), 1U of DreamTaq (Thermo Fisher Scientific, USA), and 20 ng of template DNA. PCR was run in a PCR system 2700 (Applied Biosystems, USA): Thermocycling consisted of an initial denaturation step at 95°C (5 min), which was followed by cycles for: Universal primer 18S rRNA gene (Applied Biosystem/Ambion, USA) (95°C for 30 s, 57°C for 30 s, and 72°C for 30 s) 30 cycles; ToITS2 (95°C for 30 s, 50°C for 40 s, and 72°C for 40 s) 40 cycles; To18SA (95°C for 30 s, 54°C for 30 s, and 72°C for 30 s) 30 cycles; To18SB (95°C for 30 s, 56°C for 30 s, and 72°C for 30 s) 30 cycles; final extension step at 72°C (10 min).
All reactions were checked for amplification by gel electrophoresis.
Amplified DNA sequences were directly inserted into a pGEM-T Easy Vector System (Promega, USA). Colony PCR was performed on putatively transformed colonies using M13Forward and M13Reverse as primers. The clones that showed inserts with different molecular weights using gel electrophoresis analyses were sequenced by automated sequencing (MWG Biotech). The sequences were analyzed using BLASTN (https://blast.ncbi.nlm.nih.gov/Blast.cgi) in order to identify them in the GeneBank.

Viviani A., Bernardi R., Cavallini A, & Rossi E. (2019). Genotypic Characterization of Torymus sinensis (Hymenoptera: Torymidae) After Its Introduction in Tuscany (Italy) for the Biological Control of Dryocosmus kuriphilus (Hymenoptera: Cynipidae). Journal of Insect Science, 19(4), 17.

+ Open protocol

+ Expand

Validation of PSR Primer Pairs via Gradient PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

PSR primer pairs were first validated in a gradient PCR. The 25 μl PCR reaction comprised of 50 ng DNA template, 1X DreamTaq buffer (Thermo Fisher Scientific, Massachusetts, United States), 0.4 µM each forward and reverse primer (Integrated DNA Technologies, Iowa, United States), 260 µM dNTP mix (Thermo Fisher Scientific), and 2 U DreamTaq DNA Polymerase (Thermo Fisher Scientific). PCR was carried out in a T100 Thermal Cycler (Bio-Rad, California, United States) at the following reaction conditions: 94°C for 3 min, 35 cycles of 94°C for 30 s, annealing at 60–65°C depending upon the primer pairs for 50 s, 72°C for 50 s, and a final extension at 72°C for 10 min. PCR products were resolved on 2% agarose gel (Lonza, Rockland, United States) stained with GoodView (BR Biochem, New Delhi, India) and visualized in a gel documentation system (MaestroGen Inc, Hsinchu City, Taiwan) with a 1 kb plus DNA ladder (Thermo Fisher Scientific).

Jangra S., Ghosh A., Mukherjee S., Baranwal V.K, & Dietzgen R.G. (2022). Development of a Polymerase Spiral Reaction-Based Isothermal Assay for Rapid Identification of Thrips palmi. Frontiers in Molecular Biosciences, 9, 853339.

+ Open protocol

+ Expand

Screening Bacillus for Antimicrobial Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA of Bacillus spp. was used as a template for examining the presence of AMP genes, including bmyB (bacillomycin L synthetase B), fenD (fengycin synthetase), ituC (iturin A synthetase C), srfAA (surfactin synthetase subunit 1), bacA (bacilysin biosynthesis protein), and spaS (subtilin) [31 (link)](Mora et al., 2011). All PCR amplifications were performed in 25 μL reactions containing 100 μg of genomic DNA template, 2.5 μL of 10x DreamTaq Buffer, 0.2 mM dNTP (Thermo Scientific, Hong Kong, China), 0.5 μM of each primer (Table 1), and 0.6 U of DreamTaq DNA Polymerase (Thermo Scientific, Hong Kong, China). All reactions were run on a MyCycler (Bio-Rad, Hong Kong, China). The cycling conditions for the amplification of all targets were as follows: initial denaturation at 95 °C for 2 min; 35 cycles of 95 °C for 30 s, 55 °C for 30 s and 72 °C for 40 s; and a final extension at 72 °C for 5 min. The PCR amplicons were analyzed in a 2% (w/v) agarose gel.

Proespraiwong P., Mavichak R., Imaizumi K., Hirono I, & Unajak S. (2023). Evaluation of Bacillus spp. as Potent Probiotics with Reduction in AHPND-Related Mortality and Facilitating Growth Performance of Pacific White Shrimp (Litopenaeus vannamei) Farms. Microorganisms, 11(9), 2176.

+ Open protocol

+ Expand

Molecular Detection of Leishmania in Blood

Check if the same lab product or an alternative is used in the 5 most similar protocols

We carried out the detections in 57 individual specimens (blood-fed: n = 40; unfed: 17) by PCR amplification of the Leishmania internal transcribed spacer 1 (ITS1) region using L5.8S and LITSR primers [30 (link)]. The 20-μl PCR mixtures contained 1× Dream Taq buffer with 2 mM MgCl₂ (Thermo Scientific, USA), 0.25 mM dNTPs mix, 500 nM of each primer, 2 U of Dream Taq DNA polymerase (Thermo Scientific, USA), 5–10 ng of DNA template, and nuclease-free water (Sigma, St. Louis, MO, USA). We included both positive controls [DNA from L. major—Friedlin str. and L. donovani (NLB065) and negative control (nuclease-free water)] in each PCR reaction. We performed all the reactions in a SimpliAmp thermal cycler (Applied Biosystems, Loughborough, UK). The cycling conditions included an initial denaturation for 2 min at 98 °C, followed by 35 cycles of denaturation for 20 s at 95 °C, annealing for 30 s at 53 °C, an extension for 30 s at 72 °C, and a final extension at 72 °C for 5 min. The PCR products were run in 1.5% agarose gel stained with 1× ethidium bromide (Thermo Scientific, USA) and visualised in a GenoPlex gel documentation and analysis system (VWR, USA). The amplicons from positive samples were purified as aforementioned and submitted for sequencing at Macrogen (The Netherlands) using both the forward and reverse primers.

Owino B.O., Mwangi J.M., Kiplagat S., Mwangi H.N., Ingonga J.M., Chebet A., Ngumbi P.M., Villinger J., Masiga D.K, & Matoke-Muhia D. (2021). Molecular detection of Leishmania donovani, Leishmania major, and Trypanosoma species in Sergentomyia squamipleuris sand flies from a visceral leishmaniasis focus in Merti sub-County, eastern Kenya. Parasites & Vectors, 14, 53.

+ Open protocol

+ Expand

Multiplex PCR for HPV E6 Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

E6ORF_For5′-ATGCACCAAAAGAGAACTGC-3′ and E6ORF_Rev5′-TTACAGCTGGGTTTCTCTACGTGT-3′ primers were designed to target the ORF of E6Fl, E6*I and E6*II. PCR were performed with 0.5 μM of each primer, 0.625 U DreamTaq Polymerase (ThermoFisher Scientific, Waltham, USA), DreamTaq Buffer 1X and 2.5 μL of cDNA. Amplification consisted in a first step at 95°C for 2 min followed by 30 cycles of denaturation at 95°C (30 sec), hybridization at 50°C (20 sec), elongation at 72°C (30 sec) and a final step at 72°C for 5 min. After electrophoresis on a 2% agarose gel, PCR product levels were normalized to β2 microglobulin using densitometry.

Morel A., Baguet A., Perrard J., Demeret C., Jacquin E., Guenat D., Mougin C, & Prétet J.L. (2017). 5azadC treatment upregulates miR-375 level and represses HPV16 E6 expression. Oncotarget, 8(28), 46163-46176.

+ Open protocol

+ Expand

Isolation of SecARS Sequences in Rye

Check if the same lab product or an alternative is used in the 5 most similar protocols

Based on the DNA fragments including sequences coding for ARS enzymes in sorghum and rice available in databases, primer pairs were designed using the Primer3 program and used for amplification in rye DNA. Amplicons were compared in ClustalW (United Kingdom). The resulting amplicons were sequenced and compared with the source sequences followed by designing rye specific primers. The rye-specific primers were used for screening a rye BAC library in order to pick out BAC clones containing the SecARS sequence. The sequences of the specific rye primers were as follows: forward primer – ATCTTCGCCGAGAACCTGTT; reverse primer – CCTCGTGGTCGTACAGGTC. PCRs were conducted in 15 µL volumes containing 50 ng of genomic DNA, 0.5 U of DreamTaq polymerase (Thermo Scientific, Waltham, USA), 1.5 x DreamTaq buffer, 0.2 mM dNTPs and 0.2 µM of each primer. Amplification was carried out in an Arktik Thermal Cycler (Thermo Scientific, Waltham, USA) under conditions specified by the polymerase producer. The amplified products were separated on 1% agarose gel.

Targońska-Karasek M., Kwiatek M., Groszyk J., Walczewski J., Kowalczyk M., Pawelec S., Boczkowska M, & Rucińska A. (2023). Characteristic of the gene candidate SecARS encoding alkylresorcinol synthase in Secale. Molecular Biology Reports, 50(10), 8373-8383.

+ Open protocol

+ Expand

N34S Mutation Detection in SPINK1 Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primer sequences for detection of N34S mutation in the SPINK1 gene (NCBI Reference Sequence NG_008356.2) were adapted as described previously [38 (link)]. The sequences were the following: forward primer 5′-CTC TTA CTG GAG TAG AAT GCA-3′, reverse primer 5′-GTT TGC TTT TCT CGG GGT GAG-3′. PCR reactions contained 2.5 µL of 10X DreamTaq Buffer (includes 20 mM MgCl₂; ThermoFisher Scientific, Waltham, MA, USA), 0.5 µL of dNTP mix (10 mM each; ThermoFisher Scientific), 1 µL of each primer (10 µM), 2 µL of template and 0.125 µL of DreamTaq DNA Polymerase (5 U/µL; ThermoFisher Scientific) with sterile water that was used to adjust the final volume to 25 µL. The following cycling conditions were used: 95 °C for 3 min (initial denaturation), 95 °C for 30 s, 54 °C for 30 s, 72 °C for 1 min (cycling repeated 36 times) and final extension at 72 °C for 2 min. A total of 20 µL of PCR product was digested with 3 µL of HpyCH4III restriction enzyme (5 U/µL; New England Biolabs, Ipswich, UK) by following manufacturer´s instructions. Digested samples were run in commercial 5% polyacrylamide Mini-PROTEAN TBE Precast Gels (Bio-Rad Laboratories, Hercules, CA, USA). The N34S mutation produces two additional bands at 109 and 189 bp by cutting the 298 bp fragment present in wild-type samples among other fragments [38 (link)].

Nikkola A., Mäkelä K.A., Herzig K.H., Mutt S.J., Prasannan A., Seppänen H., Lehtimäki T., Kähönen M., Raitakari O., Seppälä I., Pakkanen P., Nordback I., Sand J, & Laukkarinen J. (2022). Pancreatic Secretory Trypsin Inhibitor (SPINK1) Gene Mutation in Patients with Acute Alcohol Pancreatitis (AAP) Compared to Healthy Controls and Heavy Alcohol Users without Pancreatitis. International Journal of Molecular Sciences, 23(24), 15726.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!