Si zeb1

Small interfering RNAs (siRNAs) for SNHG5 and ZEB1 and control siRNA were provided by RiboBio. The siRNA sequences were as below: si‐SNHG5, 5′‐AGUAAUAACAAAAAGGAACAU‐3′; si‐ZEB1, 5′‐GGATAAAGAGATGGAAGAA‐3′. miR‐205‐5p mimic, NC mimic, miR‐205‐5p inhibitor and NC inhibitor were also provided by RiboBio. A SNHG5 overexpression vector (pcDNA3.1/SNHG5) and empty vector (pcDNA3.1/Control) were obtained from GeneChem Co.. Vectors containing short hairpin RNAs targeting SNHG5 (sh‐SNHG5) and negative control vector (sh‐NC) were also provided by GeneChem Co.. The sequences of sh‐SNHG5 and SNHG5 overexpressing vectors are listed in Table S1. Lipofectamine 2000 (Invitrogen) was used to transfect the above RNA oligoribonucleotides or constructs into ccRCC cells following the manufacturer's recommendation.

siNC (160818) and siZEB1 (sense: 5′-GCUGAAAGUCAAGCAAGCAAGCATT-3′, antisense: 5′-UGCUUGCUUGACUUUCAGCTT-3′) were synthesized by Guangzhou RiboBio Co AGS and MGC803 cells were transfected with siNC or siZEB1 using a lipofectamine RNAiMAX transfection reagent (13778-150, Thermo Fisher Scientific) according to a method described previously (51 (link)).

Negative control siRNA (si-NC) and ZEB1-specific siRNAs (si-ZEB1) were purchased from RiboBio (Guangzhou, China). BMSCs were cultured to 75–80% confluence in six-well plates and were transfected with 40 nM of ZEB1 siRNAs using RNAiMAX (Invitrogen, United States). After transfection for 24 h, the medium was replaced with an osteogenic medium to determine their cell fate-specific differentiation potential.