Gotaq qpcr master mix

To evaluate the expression of CLCN1 mRNA transcripts, we used cDNA samples (muscle) of three homozygous “wild type,” three heterozygous, and three homozygous recessive pigs (confirmed by sequencing). Primer sets (S5 Table) were designed to amplify three different fragments of the CLCN1 mRNA, a region of the exon 8 (P8) upstream to the deletion, a region between the exons 15 and 16 (P15/16) at the deletion, and a region between the exons 14 and 17 (P14/17) with the reverse primer at the splice junction (Fig. 5). A primer set was also designed to amplify a fragment of the pig β-actin mRNA (XM_021086047.1) that was used as the reference gene. Real-time PCR reactions were performed in triplicate in a total of 20 μL, containing 0.2 μM of each forward and reverse primer, 2 μL of cDNA (approximately 26 ng), 10 μL of GoTaq qPCR Master Mix (Applied Biosystems), and water nuclease-free q.s.p. A no-template control was included in each plate. All reactions were carried out using a 7500 Real-Time PCR System (Applied Biosystems, USA). PCR conditions were: initial denaturation at 95 °C for 10 min, 40 cycles at 95 °C for 15 sec and 60 °C for 60 sec, followed by a melting curve to confirm specific amplification of products. Relative gene expression of the CLCN1 mRNA transcripts was performed using the comparative Ct method described elsewhere^{76 (link)}.

WB was performed using an anti-CHAF1A (ab126625, Abcam, UK) antibody according to standard protocols. Briefly, after extraction and quantification, total proteins were separated by SDS-PAGE and subsequently transferred onto PVDF membranes (Millipore, Bedford, MA, USA). Then, the membranes were blocked with 5% nonfat dry milk and incubated with ab126625 overnight at 4 °C. Finally, immunoblots were probed with ECL detection reagent (Millipore).
RT-PCR analysis of cDNA was performed using GoTaq qPCR Master Mix and an ABI7300 instrument (Applied Biosystems, USA) according to the manufacturer’s instructions. Briefly, TRIzol (Invitrogen, USA) was used to prepare total RNA, and the Access Reverse Transcriptase-PCR System (Promega, USA) was used to synthesize cDNA.

The relative expressions of 10 genes were determined by quantitative PCR (qPCR), and β-actin was selected as a housekeeping gene. The TRNzol reagent extracted total RNA of HT-29 cells, and cDNA was synthesized using the PrimeScript™ reverse transcriptase (RT) reagent kit (Perfect Real Time) according to specification. The PCR reactions were performed using GoTaq^® qPCR Master Mix on a QuantStudio™ 3 Real-Time PCR System (Applied Biosystems, United States). The PCR primers are shown in Supplementary Table 1. Fold changes between the different groups were calculated using the 2^–ΔΔ cycle threshold method (Livak and Schmittgen, 2001 (link)).

The RNA was isolated using Trizol (Zymo Research, Irvine, CA, USA) and cDNA was synthesized with iScript reverse transcriptase (RT) (Biorad) using a 1 : 1 mixture of oligodT and random primers. (‐RT) controls were generated by replacing the iScript RT with water. qPCR was performed in triplicates with 1 : 10 diluted cDNA using a Go Taq qPCR master mix at Applied Biosystems (Foster City, CA, USA) 7500 Fast Real Time machine. Relative expression levels were determined after normalization to rpl13a. The following primers were used: hamster cdx4: 5′‐GGCCCCAACTTACCCACATT‐3′ and 5′‐GCTTGAGGGCAAGTCGTTCA‐3′; hamster axin2: 5′‐AGGTGTGGGGAAGGTCTTACA‐3′ and 5′‐TCTCAAGTATCCGACGCAGC‐3′; hamster rpl13a: 5′‐AAAAACGGATGGTGGTCCCT‐3′ and 5′‐CTTGGCCTTTTCCTTGCGTT‐3′.

Total RNA was prepared from quadriceps muscles using the RNeasy Fibrous Tissue Mini Kit. Complementary DNA generated with the GoScript Reverse Transcription System was analyzed by the StepOne Real-Time PCR System (Applied Biosystems, Foster City, CA) using the GoTaq qPCR Master Mix. Each sample was run in duplicate, and the mean value was used to calculate the mRNA level of the gene of interest. All data were normalized to 18s ribosomal RNA using the standard curve method. The primer sequences are listed in Supplemental Table 1.

Sorted cells (Mito-High 10% and Mito-Low 10%) were washed with PBS. DNA genome was isolated and purified with GenElute™ Mammalian Genomic DNA Miniprep Kit. qPCR analyses were performed in triplicate on a 7500 Fast Real-Time PCR System (Applied Biosystems) with a new fluorescent DNA-binding dye-based (similar with SyberGreen I) GoTaq^® qPCR Master Mix. qPCR cycling parameters are used as follows: 10 µL-reaction system, Initial denaturation 95 °C, 2 min, 1 cycle; Denaturation 95 °C, 3  s, Annealing extension 68 °C, 30  s, 40 cycles. Relative quantification (mtDNA:nDNA ratio) was calculated using the ΔΔCt method upon targeting of nuclear-encoded genes(human β-globin_Fwd: 5′-GGCTGTCTCCTAGCAACGAC-3′, human β-globin_Rev: 5′-TGCATACCAGCTCTCACCTG-3′ and mitochondrial genome (221 bp human mitochondrial genome fragment_Fwd: 5′-CCC CAC AAA CCC CAT TAC TAA ACC CA-3′, human mitochondrial genome fragment_Rev: 5′-TTT CAT CAT GCG GAG ATG TTG GAT GG-3′) [19 (link)].

Total RNA was extracted from cells using the RNeasy minikit (Qiagen S.r.l., Milan, Italy) according to the manufacturer's instructions. 1 μg of RNA was reverse transcribed in a final volume of 50 μl using the High Capacity cDNA Reverse Transcription kit (Invitrogen). 5 μl of the resulting cDNA was used for qPCR with a 7900 HT Fast real-time PCR system (Applied Biosystems by Invitrogen) using GoTaq® qPCR Master Mix (containing Sybr® green dye) and specific primers for mouse Tlr2 Tlr3, Tlr7, Tlr8, Unc93b1. All the data obtained were normalized to Hprt1 housekeeping gene expression.