Mrna sequencing sample preparation guide

Total RNA was extracted from homogenized tissue with TRI reagent (Molecular Research Center) as described previously by Clark et al. (73 (link)). Preparation of cDNA used N₆ primers following the Illumina mRNA sequencing sample preparation guide. The quality of the cDNA samples was verified with an Agilent 423 Technologies Bioanalyzer to ensure an insertion size of between 150 to 225 bp and by quantitative PCR (qPCR) (Kapa Biosystems) to ensure an RNA concentration of ≥0.5 ng/μl. Sequencing libraries were produced by the use of the Illumina TruSeq stranded-RNA protocol.

RNA was isolated in triplicates from PE01 and PE04 cell lines using the RNeasy Kit (Qiagen), and the quality of RNA was checked using a Bioanalyser. From each sample, 5 μg of RNA was used to perform RNA‐Seq using the Illumina mRNA Sequencing Sample Preparation Guide (Illumina, Cat # RS‐930‐1001). First poly‐A containing mRNA was purified using poly‐T oligo‐attached magnetic beads and then fragmented using divalent cations under elevated temperatures. Then, the first and second strand cDNA was synthesized using random primers, end‐repaired, adenylated, and ligated with paired‐end adapters. The products were then purified and enriched with PCR to create the final cDNA library. The library from each sample was sequenced in a single lane of an Illumina GAIIx using a standard 40‐bp paired‐end protocol. Reads were mapped to the UCSC Homo sapiens reference genome hg19 and their relative expression values were calculated in RPKM using CLC Biosystems Genomic Workbench software.

RNA amplification was performed by in vitro transcription of an oligo dT-primer fused T7 promoter producing up to a 10,000-fold increase in mRNA using one round of a TargetAmp aRNA Amplification Kit (Epicentre). The resulting in vitro amplified RNA was used for a standard RNA-seq protocol (Illumina mRNA Sequencing Sample Preparation Guide, September 2009). Magna beads were used for purification steps and for the final purification. Gel extraction was not necessary due to the size of in vitro amplified RNA fragments. Samples were sequenced on either GA-2 or Hi-Seq Illumina sequencers with either 36 or 50 rounds of sequencing. Data from this study are available on NCBI GEO (GSE59943)
Reviewer access: http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE59943

mRNA-Seq library construction and sequencing were performed by Novogen Bioinformatics Technology Co., Ltd (Hong Kong). Briefly, a library of insert size 250 ~ 300 bp was constructed, followed by its sequencing by pair-end readings of 150 bp. Following random mRNA fragmentation, cDNA was synthesized by using random hexamer primers and reverse transcriptase. Then the synthesis of the complementary strand was carried out following the Illumina mRNA Sequencing Sample Preparation Guide. A series of the end terminal repair and ligation of the pair-end sequencing adaptors was performed. The employed adapters were: 5' adapter 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and 3' adapter 5'-GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG, where the six underlined bases correspond to the index. Size selection and PCR amplification enrichment were performed. The quality testing of the library was done using Qubit 2.0 and Bioanalyzer 2100, and the effective concentration of the library was quantified accurately by Q-PCR.
The mRNA-Seq libraries were sequenced by an Illumina HiSeq/MiSeq sequencer. Raw readings were filtered to eliminate low quality readings and adapters. Those readings containing sequences of adapters, or 10% of their indeterminate bases or more than 50% of low quality bases (Qscore < = 5), were eliminated.

For quantification of extracellular glucose, glutamate, and ALA, aliquots of the culture were withdrawn and the cells were removed by centrifugation (12,000×g, 10 min). The OD₆₀₀ was determined using a spectrophotometer (Shimadzu, Japan), and the supernatant was analyzed for glucose and glutamate using a SBA-40C biosensor (developed by Biology Institute of Shandong Academy of Sciences) equipped with glucose and glutamate oxidase immobilized on membranes. To determine the concentrations of organic acids, high-performance liquid chromatography (HPLC) was used (Shimadzu). The supernatant was filtered through a 0.22-mm syringe filter. The HPLC system was equipped with a HPX-87H column (300 mm × 7.8 mm, Bio-Rad, USA) and a differential refractive index (RI) detector (Shimadzu RID-10A). The mobile phase (0.5 mM H₂SO₄) was delivered at 0.6 mL/min at 65 °C. To measure ALA and PBG concentrations, we used modified Ehrlich’s reagent and measured absorbance at 554 nm [42 (link)]. For heme measurements, a fluorescence assay was used [43 (link)]. RNA-Seq was performed according to the Illumina mRNA Sequencing Sample Preparation Guide (Illumina), and sequenced using an Illumina HiSeq sequencer (Illumina) at BGI Tech Company (Shenzhen, China). The raw sequencing data were analyzed using the software included with the system (Illumina).

mRNA-Seq libraries were generated by following the Illumina mRNA Sequencing Sample Preparation Guide. Briefly, poly (A) RNA was fragmented into small pieces by using divalent cations at 94 °C for 5 min. The fragmented mRNA was converted into cDNA by using random-primers and reverse transcriptase; after 2nd-strand cDNA synthesis, end repair and A-tailing, pair-end adaptors were ligated to cDNA ends. Ligated DNA was separated on a 2% agarose gel and DNA in the 200-bp (±25 bp) range was excised, gel-purified and enriched by PCR amplification with 15 cycles. After PCR product purification and quality testing by using BioAnalyzer (Agilent), mRNA-Seq libraries were sequenced by Illumina HiSeq 2000. In total, eight mRNA-Seq libraries were generated and sequenced (IR29c, IR29c-ps, IR29s, IR29s-ps, POKc, POKc-ps, POKs and POKs-ps, representing samples of IR29 control, polysomal fractions of IR29 control, IR29 salt stress, polysomal fractions of IR29 salt stress, Pok control, polysomal fractions of Pok control, Pok salt stress and polysomal fractions of Pok salt stress, respectively).