Gene expression was measured using Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR). First-strand cDNA was synthesized with Ready-To-Go You- Prime First-Strand Beads (Amersham Biosciences, Piscataway, NJ) with 1 μg of total cellular RNA (from 107 cells) and 100 ng of random hexadeoxynucleotide primer (Amersham Biosciences, Piscataway, NJ). After synthesis, the reaction mixture was immediately subjected to qPCR. Three cDNA samples from separate RNA extractions and reverse transcription reactions were used for each cell line. qPCR was performed using SYBER Green Master Mix as detection agent. A fold-change < 1 (control) represented downregulation of the correspondent gene. The fold-change was calculated using the following formula: 2(-ΔCCT). The sequences of primers were: GAPDH ATCGAAATCCCATCACCATCTT (sense), CGCCCCACTTGATTTTGG (antisense) and hQCF3 GACAGTTGTTGGCGGTTGCT (sense), ACCCTC TGAAGGCTCCAGTTC (antisense) [26 (link)].
Random hexadeoxynucleotide primer
Manufactured by Cytiva
Random hexadeoxynucleotide primer is a short, synthetic DNA sequence composed of six randomly selected nucleotides. This product is commonly used as a primer in various molecular biology techniques, such as polymerase chain reaction (PCR) and reverse transcription, to amplify target DNA or RNA sequences.
Automatically generated - may contain errors
5 protocols using random hexadeoxynucleotide primer
1
Quantitative Analysis of Gene Expression
2
Quantifying MMP2 Gene Expression in Ovarian Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from ovarian cancer cell lines using RNeasy kit (Qiagen, Frederick, MA) following the manufacturer’s protocol. Ready-To-Go You-Prime First Strand Beads (Amersham Biosciences, Piscataway, NJ) was mixed with 1 μg of total RNA and 100 ng of random hexadeoxynucleotide primer (Amersham Biosciences, Piscataway, NJ) to synthesize cDNA. The reaction mixture was subjected to quantitative polymerase chain reaction (qPCR) using SYBR® Green Master Mix as a detection agent. Qiagen (Frederick, MA) software was used to calculate difference in MMP2 gene expression between the cell lines by first normalizing the MMP2 gene expression in each cell line with that of β-actin, a housekeeping gene.
3
Quantitative Analysis of Gene Expression
4
Mouse Lung RNA Isolation and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse lungs were extracted, trachea and mainstream bronchi were separated, lungs were frozen and homogenized as described 33 (link). RNA was isolated using RNeasy kit (Qiagen, Valencia, CA) according to manufacturer's protocol. First-strand cDNA was synthesized with Ready-To-Go You- Prime First-Strand Beads (Amersham Biosciences, Piscataway, NJ) with 1 μg of total cellular RNA (from 107 cells) and 100 ng of random hexadeoxynucleotide primer (Amersham Biosciences, Piscataway, NJ). Then, the reaction mixture was immediately subjected to Quantitative Reverse Transcription Polymerase Chain Reaction - QRT-PCR (Applied Biosystems, Inc., Foster City, CA) using previously developed and validated sets of EGFR-TK primers 34 (link), 35 (link).
5
Quantifying Lung Fibrosis Gene Expression
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!