Magna chip a g chromatin immunoprecipitation kit

ChIP assays were performed using the Magna ChIP^™ A/G Chromatin Immunoprecipitation Kit (Merck). Briefly, the cells were fixed with formaldehyde and sonicated, and incubated with the target protein. The cross-linked DNA fragments were then released from the co-precipitated complexes, purified, and resuspended in ddH2O. Through PCR amplification, interactions between ERG and ICAM2 promoter were evaluated. The ChIP-PCR primer targeting the ICAM2 promoter region was (5′ to 3′) ICAM2-site1-F, AAAGCGGAATGGGAGTGG; ICAM2-site1-R, AGTGACGTGCTTCCTGTG.

ChIP analysis was performed using Magna ChIP A/G chromatin immunoprecipitation kit (Merck Millipore, MA, USA) as per manufacturer’s protocol on cells isolated from NT and TT by ED. Briefly, nuclear lysate was prepared as per manufacturer’s protocol and sonicated using Covaris S2 system (Covaris, MA, USA) to make small DNA fragments (100–200 base pairs) and then incubated with ChIP grade anti-Histone H3 rabbit mAb (Active Motif, CA, USA), anti-Histone H3 (tri methyl K9) rabbit mAb (Abcam Cambridge, UK), and anti-Histone H3 (tri methyl K27) rabbit mAb (Abcam). Isotype-matched control antibodies were used as negative controls. Immune complexes containing DNA fragments were precipitated using Magna A/G beads (supplied with the kit). Relative enrichment of target regions in the precipitated DNA fragments was analyzed by qPCR using PowerUP SYBER Green Master Mix (Applied Biosystems) on QuantStudio 7 Flex platform (Applied Biosystems). Sequences of primers are listed in Additional file 1: Table S1d. All data were normalized to input controls. Non-specific amplification was checked by using melting curve and agarose gel electrophoresis.

ChIP was performed with Magna ChIP™ A/G Chromatin Immunoprecipitation Kit (Merck Millipore, Burlington, MA, USA) and anti-p-STAT3 (1:50, #9134, CST) antibody or IgG (1:50, #3900, CST). After ChIP, the qPCR was applied for quantifying immunoprecipitated DNA, with the following primers targeted to the Anxa2 promoter sequence (Forward: CCCAGTTCAGAGGAATCCAA; Reverse: CCAGGCCCTACAAGTATCCA).

Chromatin immunoprecipitation (ChIP) was performed using the Magna ChIP™ A/G Chromatin Immunoprecipitation Kit (Merck Millipore, Burlington, MA, USA) with an antibody specific for NRF2 (Abcam, Cambridge, MA., USA), c-MYC (Abcam, Cambridge, MA., USA) or normal rabbit IgG (Santa Cruz Biotechnology, Santa Cruz, CA., USA). Following ChIP, quantitative PCR was utilized to amplify and quantify the immunoprecipitated DNA using primers specific for the NRF2-targeted antioxidant response element (ARE) within G6PD or TKT, as well as primers for a c-MYC binding site within the NRF2 promoter region (Table S4). The c-MYC binding site within the NRF2 promoter region was obtained from the ENCODE Consortium. The ChIP-qPCR values were normalized to that of input control and represented as fold enrichment relative to the anti-normal rabbit IgG control.

ChIP was performed according to the instructions of the Magna ChIP™ A/G Chromatin Immunoprecipitation Kit (Merck Millipore Corporation). The nuclear DNA extracts were amplified using primers that spanned the EGLN2 promoter region containing putative TCF7L2-binding sites. ChIP grade TCF7L2 antibody was purchased from Cell Signaling Technology. Primer sequences were F: 5′-GTGAGCCACTGCGTCCATCCAGAT-3′ and R: 5′-GTCCATACCTTTCTTCTCCCGGTT-3′. Quantitative ChIP was performed according to previously reported methods^{40 (link)}.