Xmark microplate reader

The effect of the ligand-aptamer complex on cell membrane integrity was assessed by the lactate dehydrogenase (LDH) assay using Pierce™ LDH Cytotoxicity Assay Kit (Thermo Fisher Scientific, USA). Cells were seeded in 48-well plates (5 × 10³ cells/well) and incubated overnight for cell adhesion. Then, cells were incubated for 7 days with the preformed ligand-aptamer complex using the same compound/DNA concentrations used for MTT assay (15 μM aptamer and 1 μM C₈). After exposure, 50 μL/well of supernatant were transferred into optically clear 96-well flat-bottom microplates and mixed with 50 μL/well of reaction mixture and incubated for 30 min at room temperature. The absorbance of the samples was then measured at 490 nm using a Bio-Rad xMark™ microplate reader. The percentage of cytotoxicity is calculated with the following equation⁹ : $$\%cytotoxicity=\frac{\mathrm{Experimental}\mathrm{LDH}\mathrm{release}({\mathrm{OD}}_{490})}{\mathrm{Maximum}\mathrm{LDH}\mathrm{release}({\mathrm{OD}}_{490})}\times 100$$
Cells treated with lysis buffer were used as positive control (maximum LDH release). The experiments were performed in at least two different plates for each cell line, using triplicate wells for each condition.

The MTT assay was performed to assess the cytotoxicity of actinomycins, X₂, and D. The mice macrophages were cultivated for 24 h in RPMI-1640 medium supplemented with 10% (v/v) FBS in microtiter plates (5 × 10³ cells/well/200 μL) at 37 °C with 5 % CO₂. After washing the cells with PBS, cells were treated with actinomycins, X₂, and D for 72 h at differing concentrations, i.e., 25, 8.3, 2.7, 0.9, 0.3, and 0.1 µg/mL in RPMI-1640 medium supplemented with 10% (v/v) FBS. The cells with 10 % (v/v) FBS served as the negative control. After removing the supernatant, a mixture of 50 μL RPMI-1640 medium and 14 μL of MTT (0.5% w/v) was dispensed and incubated for 4 h. After removing the supernatant, 200 μL DMSO was used to solubilize the insoluble formazan produced by living cells from MTT. The colorimetric analysis was performed using the Bio-Rad X-Mark microplate reader at 540 nm. The cytotoxic effects were quantified using CC₅₀ values (the concentration at which 50% of viable cells were killed). Each test was performed in triplicate, and the findings were recorded in mean ± SD [2 (link),3 (link),4 (link)].

The effects of compounds on the NO production in LPS-stimulated RAW264.7 cells were evaluated as previously described [19 (link)]. The cells were seeded in 96-well plate at 2 × 10⁵ cells/well and incubated for 12 h. The plate were pretreated with compounds in various concentrations (from 1 to 30 µM) for 30 min and then incubated for another 24 h with or without 1 μg/ml LPS. 100 μl of the culture supernatant were transferred to other 96-well plate and 100 μl of Griess reagent were added. The absorbance of the reaction solution was read at 570 nm with a microplate reader (XMark microplate reader, Biorad, USA). The remaining cell solutions in cultured 96-well plate were used to evaluate cell viability by 3-(4,5-dimethylthiazole-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay. Cardamonin was used as a positive control (IC₅₀ = 2.80 μM).

PCR-based telomeric repeat amplification protocol (TRAP) was performed as previously described in ref. ⁸⁰ . Primers TS (aatccgtcgagcagagtt) and ACX (gcgcggcttacccttacccttaccctaacc) were used for amplification of telomeric repeats. TSNT (aatccgtcgagcagagttaaaaggccgagaagcgat) and NT (atcgcttctcggcctttt) were used as an internal control. Protein extracts were generated by repeated freeze–thaw cycles in hypotonic lysis buffer (HLB) (20 mM HEPES, 2 mM MgCl₂, 0.2 mM EGTA, 10% glycerol, 1 mM dithiothreitol, 0.1 mM PMSF, 0.5% CHAPS). Protein concentrations were determined by Bio-Rad Protein Assay colorimetric dye quantified by a Bio-Rad xMark microplate reader. 200 ng of total protein were used for input into ³²P-dGTP PCR. TRAP products were resolved on a 10% polyacrylamide in 1× TAE gel. Dried gels were visualized by exposure on a phosphorimager screen.

Cancer cells at logarithmic growth phase were digested by 0.25 % trypsin, adjusted to the concentration of 2 × 10⁴ cells/mL, inoculated into 96-well cell culture plates (200 μL per well) and then cultured at 37 °C for 24 h. After treatment with various concentrations of TFPNCD (5, 10, 20, 30, 40, 50, 60, 80, 100 μg /mL) for 44 h, the cell proliferation was measured by MTT assay according to the manufacturer’s instructions. Briefly, 20 μL of MTT reagent (5 mg/mL) was added to each cluster well and incubated at 37 °C for 4 h. The medium with MTT was then removed and 150 μL of DMSO was added to solubilize the formazan crystals. The plates were agitated gently for 6 min at room temperature. The absorbance value per well was determined at 570 nm using a xMark microplate reader (BioRad Co., USA). All assays were repeated three times. The cell proliferation inhibition rate (%) was calculated as follows: Cell proliferation inhibition rate (%) = (1 - mean OD value / control mean OD value) × 100.

Conditioned media from 48 hrs cell cultures were harvested, and ELISA was performed according to the manufacturer's instructions (R&D Systems, Minneapolis, MN). The OD was used at 450 nm on x-mark microplate reader (Bio-Rad).

Absorbances at 600 nm (OD₆₀₀) of 96 µL aliquots per sample, for all the samples were measured with xMark Microplate Reader (Bio-Rad, Hercules, CA, USA). Each OD₆₀₀ was calculated as follows: $${\text{OD}}_{600}\text{of}\text{each}\text{sample}-{\text{OD}}_{600}\text{of}2.5\%\text{LB}\text{Miller}\text{medium}$$