Log In Sign up
The largest database of trusted experimental protocols

Kit 9860

Manufactured by Cell Signaling Technology
Visit Supplier

Kit #9860 is a protein extraction and quantification kit designed for the isolation and measurement of proteins from biological samples. The kit includes reagents and protocols for cell lysis, protein extraction, and protein concentration determination using a colorimetric assay. The core function of this kit is to provide researchers with a reliable and standardized method for obtaining protein samples from cells or tissues for downstream applications.

Automatically generated - may contain errors

Lab products found in correlation

Oligo dt primer, by Thermo Fisher Scientific (2 mentions) Ssoadvanced universal sybr green supermix, by Takara Bio (2 mentions) Thermal cycler dice real time system, by Takara Bio (2 mentions) Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (2 mentions) Rneasy mini kit, by Qiagen (2 mentions) Sa β gal, by Cell Signaling Technology (1 mentions) Cellevent senescence green detection kit, by Thermo Fisher Scientific (1 mentions)

11 protocols using kit 9860

1

Kidney Senescence Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
Fresh snap-frozen kidneys were cut into thick 8μM sections and stained with SA-β-gal per kit instructions (Cell Signaling Kit #9860) and counter stained with nuclear fast red. Five low power (40x) images per kidney were quantified using ImageJ (version 1.48, National Institutes of Health). Positive binary staining threshold was determined by eye for three sections and then the average threshold applied to all other images automatically to determine the percent of positive area. Image areas lacking tissue were excluded.
Sweetwyne M.T., Pippin J.W., Eng D.G., Hudkins K.L., Chiao Y.A., Campbell M.D., Marcinek D.J., Alpers C.E., Szeto H.H., Rabinovitch P.S, & Shankland S.J. (2017). The mitochondrial-targeted peptide, SS-31, improves glomerular architecture in mice of advanced age. Kidney international, 91(5), 1126-1145.
+ Open protocol
+ Expand
2

Quantification of Senescent Glomeruli

Check if the same lab product or an alternative is used in the 5 most similar protocols
Frozen kidney sections (10 μm) were stained with SA-β-gal per kit instructions (Cell Signaling Kit #9860), then counter stained with nuclear fast red to determine senescence-associated-β-galactosidase [89 (link), 90 (link)]. The percentage of glomeruli with SA-β-gal-positive staining in the glomerular tuft was quantified in outer cortex of each kidney section.
Kaverina N., Schweickart R.A., Chan G.C., Maggiore J.C., Eng D.G., Zeng Y., McKinzie S.R., Perry H.S., Ali A., O’Connor C., Pereira B.M., Theberge A.B., Vaughan J.C., Loretz C.J., Chang A., Hukriede N.A., Bitzer M., Pippin J.W., Wessely O, & Shankland S.J. (2023). Inhibiting NLRP3 signaling in aging podocytes improves their life- and health-span. Aging (Albany NY), 15(14), 6658-6689.
+ Open protocol
+ Expand
3

Senescence-associated β-galactosidase Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
To test whether cells displayed phenotypes consistent with entering a state of cellular senescence, a senescence‐associated β‐galactosidase (SA‐β‐gal) assay (Cell Signaling Technology, Kit #9860) was performed according to the manufacturer's protocol. In brief, after the respective treatment, cells were fixed and incubated over night with X‐gal as substrate for the SA‐β‐galactosidase at 37°C. Subsequently, the substrate solution was removed, cells were overlayed with 70% glycerol (in PBS) and imaged with a microscope (Accu‐Scope, EXI‐410, Skye Color Camera). Images were analyzed and quantified using Fiji and statistical analysis was performed using Excel (Microsoft) and Prism (GraphPad).
Russo T., Kolisnyk B., B. S. A., Plessis‐Belair J., Kim T.W., Martin J., Ni J., Pearson J.A., Park E.J., Sher R.B., Studer L, & Riessland M. (2024). The SATB1‐MIR22‐GBA axis mediates glucocerebroside accumulation inducing a cellular senescence‐like phenotype in dopaminergic neurons. Aging Cell, 23(4), e14077.
+ Open protocol
+ Expand
4

Senescence-associated β-galactosidase Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Senescence‐associated β galactosidase assay was performed according to the manufacturer's protocol and as described above (Cell Signaling Technology, Kit #9860). Five thousand cells were plated on each well of a 96‐well dish. 24 h later medium containing DMSO or 2.5 μM Glucocerebrosides (Avanti, USA) was added. The β‐gal assay was performed 7‐days after treatment was added and Fiji was used for quantification of senescent cells as described above. In the case of GBA overexpression, GluCer treatment was added 24 h post‐transfection.
Russo T., Kolisnyk B., B. S. A., Plessis‐Belair J., Kim T.W., Martin J., Ni J., Pearson J.A., Park E.J., Sher R.B., Studer L, & Riessland M. (2024). The SATB1‐MIR22‐GBA axis mediates glucocerebroside accumulation inducing a cellular senescence‐like phenotype in dopaminergic neurons. Aging Cell, 23(4), e14077.
+ Open protocol
+ Expand
5

Senescence-Associated β-Galactosidase Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
To test whether cells displayed phenotypes consistent with entering a state of cellular senescence, a senescence-associated β-galactosidase (SA-β-gal) assay (Cell Signaling Technology, Kit #9860) was performed according to the manufacturer’s protocol. In brief, after the respective treatment, cells were fixed and incubated over night with X-gal as substrate for the SA-β-galactosidase at 37°C. Subsequently, the substrate solution was removed, cells were overlayed with 70% glycerol (in PBS) and imaged with a microscope (Accu-Scope, EXI-410, Skye Color Camera). Images were analyzed and quantified using Fiji and statistical analysis was performed using Excel (Microsoft) and Prism (GraphPad).
Russo T., Kolisnyk B., Aswathy B., Wan Kim T., Martin J., Plessis-Belair J., Ni J., Pearson J.A., Park E.J., Sher R.B., Studer L, & Riessland M. (2023). The SATB1-MIR22-GBA axis mediates glucocerebroside accumulation inducing a cellular senescence-like phenotype in dopaminergic neurons. bioRxiv.
+ Open protocol
+ Expand
6

Quantifying Therapy-Induced Senescence

Check if the same lab product or an alternative is used in the 5 most similar protocols
We assayed the activation of β-galactosidase enzyme (β-gal) in SB28 and patient-derived cell lines, as a biomarker for senescent cells in different conditions. ATRX-scrambled-control or ATRX-KO, IDH1R132H OE cells were treated with 4 μM PD0332991(cDK4 inhibitor) or 200 nM Doxorubicin for 4 days. Kit #9860 (Cell Signaling Tech) was used to visualize β-gal expression, according to the manufacturer’s instructions. The CellEvent Senescence Green Detection Kit from Themofisher (Cat. # C10850) was used, according to the manufacturer’s instructions, to quantify β-gal expression in the following treatment. Therapy-induced senescence was likewise assayed in the patient-driven cell lines SF10417 and SF10602 as above, Cell Signaling Technologies Kit #9860 was used for visualization and Thermofisher kit # C10850 was used for quantification, with the following modification. Patient-derived cells were seeded and treated with 2 μM PD0332991(cDK4 inhibitor) or 100 nM Doxorubicin or 100 μM of Temozolomide (TMZ) or 2 μM Imatinib for 4 days.
Babikir H., Wang L., Shamardani K., Catalan F., Sudhir S., Aghi M.K., Raleigh D.R., Phillips J.J, & Diaz A.A. (2021). ATRX regulates glial identity and the tumor microenvironment in IDH-mutant glioma. Genome Biology, 22, 311.
+ Open protocol
+ Expand
7

Senescence Induction by Radiation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were seeded into a 6 well plate 48 h prior to radiation. 96 h following radiation cells were fixed and stained for β-Galactose using the Cell Signal Technology kit (9860) followed by cell staining with SYBR Gold and overlay with Glycerol. Three images were taken per well with percentages calculated as β-Gal positive cells over total SYBR Gold positive cells.
McSwain L.F., Pillsbury C.E., Haji-Seyed-Javadi R., Rath S.K., Chen V., Huang T., Shahab S.W., Kunhiraman H., Ross J., Price G.A., Dey A., Hambardzumyan D., MacDonald T., Yu D.S., Porter C.C, & Kenney A.M. (2023). YB1 modulates the DNA damage response in medulloblastoma. Scientific Reports, 13, 8087.
+ Open protocol
+ Expand
8

Senescence-associated β-galactosidase Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Senescence-associated β galactosidase assay was performed according to the manufacturer’s protocol and as described above (Cell Signaling Technology, Kit #9860). 5,000 cells were plated on each well of a 96-well dish. 24 hours later medium containing DMSO, 2.5, 5, 10, 20, and 40uM Glucocerebrosides (Avanti, USA) was added. The β-gal assay was performed 7-days after treatment was added and Fiji was used for quantification of senescent cells as described above.
Russo T., Kolisnyk B., Aswathy B., Wan Kim T., Martin J., Plessis-Belair J., Ni J., Pearson J.A., Park E.J., Sher R.B., Studer L, & Riessland M. (2023). The SATB1-MIR22-GBA axis mediates glucocerebroside accumulation inducing a cellular senescence-like phenotype in dopaminergic neurons. bioRxiv.
+ Open protocol
+ Expand
9

Senescence Evaluation in Frozen Kidneys

Check if the same lab product or an alternative is used in the 5 most similar protocols
Kidneys were frozen at −80° and included in Tissue-Tek OCT. Five micrometers sections were used for β-Galactosidase staining (Cell Signaling Kit #9860) according to the manufacturer’s protocol to evaluate cellular senescence (Itahana et al., 2007 (link)). Briefly, frozen sections were rinsed in phosphate buffered saline (PBS), then fixed and incubated with β-Galactosidase staining solution overnight at 37°. Negative controls were performed with the same β-Galactosidase staining solution, but lacking the X-Gal substrate of β-Galactosidase. Sections were analyzed with a Nikon Ti microscope at a magnification of 20×.
Juvet C., Siddeek B., Yzydorczyk C., Vergely C., Nardou K., Armengaud J.B., Benahmed M., Simeoni U., Cachat F, & Chehade H. (2020). Renal Programming by Transient Postnatal Overfeeding: The Role of Senescence Pathways. Frontiers in Physiology, 11, 511.
+ Open protocol
+ Expand
10

Senescence Pathway Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total KSL cells RNA was extracted using the RNeasy Mini Kit (QIAGEN) and reverse transcribed using SuperScript III First-Strand Synthesis System and Oligo (dT) primers (Invitrogen). qPCR was performed on a Thermal Cycler Dice Real Time System (Takara) using SsoAdvancedTM Universal SYBR Green Supermix and the following primer sets: p16Ink4a (GAACTCTTTCGGTCGTACCC and CGAATCTGCACCGTAGTTGA), p19Arf (GGGTTTTCTTGGTGAAGTTCG and TTGCCCATCATCATCACCT), and Trp53 (CAGTCTACTTCCCGCCATAA and GTCTCAGCCCTGAAGTCATAAG). The reaction conditions were 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec, 60°C for 30 sec, and 72°C for 20 sec. Gene expression of genes was normalized relative to Gapdh expression (using primer set: CGACTTCAACAGCAACTCCCACTCTTCC and TGGGTGGTCCAGGGTTTCTTACTCCTT). Senescence beta-galactosidase staining (Cell Signaling, kit 9860S) was performed according to the manufacturer’s instructions following cell attachment to poly-L-lysine-coated plates. For Sanger sequencing, Trp53 cDNA was PCR amplified (using primer set: CATCCTGGCTGTAGGTAGCG ACCCTATGAGGGCCCAAGAT) and sequenced using nested sequencing primers: AAAAGTCTGCCTGTCTTCCAG; TGATGGCCTGGCTCCTCC; CACGTACTCTCCTCCCCTCA; and CTTCTGTACGGCGGTCTCTC. Sanger sequencing was outsourced to FASMAC Co. Ltd, and visualized and aligned using SnapGene software.
Wilkinson A.C., Ishida R., Kikuchi M., Sudo K., Morita M., Crisostomo R.V., Yamamoto R., Loh K.M., Nakamura Y., Watanabe M., Nakauchi H, & Yamazaki S. (2019). Long-term ex vivo hematopoietic stem cell expansion affords nonconditioned transplantation. Nature, 571(7763), 117-121.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!