Methyl pyruvate

A mouse lung epithelial cell line (MLE-12; ATCC, CRL-211) was cultured in HITES media (DMEM/F12 (1:1) (Gibco, catalogue no. 11320033), 1x Insulin-Transferrin-Selenium (Gibco, catalogue no. 41400045), 10 nM Hydrocortisone (Sigma, catalogue no. H4001), 10 nM β-oestradiol (Sigma, catalogue no. E2758), 10 mM HEPES (Corning, catalogue no. 25-060-CI), 1x GlutaMAX (Gibco, catalogue no. 35050061)) supplemented with 4% FBS (Atlas Biologicals, catalogue no. F0500A), 1 mM methyl-pyruvate (Sigma-Aldrich, catalogue no. 371173), 400 µM uridine (Sigma-Aldrich, catalogue no. U3003), 50 µM l-Asparagine (Sigma-Aldrich, catalogue no. A4284; in addition to 50 µM l-asparagine in the basal medium), 1x antibiotic-antimycotic solution (Gibco, catalogue no. 15240062) and 2.5 µg ml⁻¹ Plasmocin Prophylactic (Invivogen, ant-mpp)). Cells were incubated at 37 °C, 5% CO₂ and 95% humidity.

From Cell Signaling Technology: Phospho-α1-AMPK (Thr172), α1-AMPK, IP3R-1, p53, acetyl-p53, cortactin, Drp1. From BD Laboratories: β-tubulin, IP3R-3. From Sigma: MCU, acetyl-cortactin. From Abcam: Tomm20. Secondary antibodies conjugated with peroxidase were purchased from GE Healthcare Life Science. TMRE, Fluo-4, mitotracker, BAPTA-AM, BCECF-AM, DAPI, and secondary antibodies conjugated with Alexa 488, 546, 633 were from Molecular Probes. Chemicals: methyl-pyruvate, FCCP, oligomycin, rotenone, nicotinamide (NMN), latrunculin B (LatB), cytochalasin D (CytD), and Hanks’ balanced salt solution were purchased from Sigma. EX527 and compound C were purchased from Tocris Bioscience. Xestospongin B was extracted and purified from the marine sponge Xestospongia exigua as described before (Jaimovich et al., 2005 (link)).

The 293T human embryonic kidney cell line, and PANC-1 and Capan-2 pancreatic cancer cell lines were purchased from the American Type Culture Collection and were previously tested for mycoplasma contamination. Cells were routinely cultured in Dulbecco’s Modified Eagle Medium (Macgene, China) with 10% fetal bovine serum (Hyclone, USA). The FLAG-tagged LDHB eukaryotic expression vector was generated by inserting PCR-amplified fragments of the LDHB gene into pcDNA3 (Invitrogen, USA). Lentiviral shRNA vectors of LDHA and LDHB were constructed by cloning short hairpin RNA fragments into pSIH-H1-Puro (System Biosciences, USA). Target sequences are as follows, LDHA shRNA: 5’- ATCCAGTGGATATCTTGACCTACG -3’; LDHB shRNA: 5’- GGATATACCAACTGGGCTATT -3’. Lentiviruses were produced by co-transfection of HEK293T cells with recombinant lentivirus vectors and pPACK Packaging Plasmid Mix (System Biosciences, USA) using PEI reagent (Polyscience, USA). Lentiviruses were used to infect target cells in accordance with the manufacturers’ instructions. Myc-TERT, Flag-TERT, and GST-TERT plasmids were described previously (15 (link)). Sodium pyruvate, Sodium lactate, Methyl pyruvate and IPTG were products from Sigma (USA). 2-DG and AT-101 were purchased from Selleck (USA).

Irinotecan (Sigma, 1347609) and methyl pyruvate (both Sigma-Aldrich) were dissolved in water.

¹³C₅-labeled glutamine (CLM-1822-H), ²H₆-labeled α-ketoglutaric acid (DLM-9476), ¹³C₄-labeled succinic acid (CLM-1571), and ¹⁵N-labeled alanine (NLM-454) were acquired from Cambridge Isotope Laboratories. HPLC-grade reagents, including methanol, chloroform, water, and acetone were acquired from Sigma. Oligomycin (Cayman Chemicals), FCCP (Cayman Chemicals), rotenone (Cayman Chemicals), antimycin A (Sigma), Seahorse XF^e96 XF base media (Agilent), D-glucose (Sigma), sodium chloride (Sigma), L-glutamine (Sigma), sodium pyruvate (Sigma), α-ketoglutaric acid disodium salt (Sigma), dimethyl 2-oxoglutarate (Sigma), DBE-4 (dimethyl-succinate; Sigma), DBE-5 (dimethyl-glutarate; Sigma), 1-octyl-α-ketoglutarate (Cayman Chemicals), methyl pyruvate (Sigma), tert-butyl acetate (Sigma), sodium acetate (Sigma), L-alanine methyl ester hydrochloride (Sigma), L-alanine ethyl ester hydrochloride (Sigma), L-alanine tert-butyl ester hydrochloride (Alfa Aesar), sodium fumarate dibasic (Sigma), dimethyl fumarate (Sigma), diethyl fumarate (Sigma), norvaline (Sigma), deferoxamine mesylate (Cayman Chemicals), doxycycline hyclate (Sigma), hexadimethrine bromide (Sigma), hygromycin B (Sigma), methoxyamine hydrochloride (Sigma), and MTBSTFA + 1% TBDMSCI (Sigma).