qRT-PCR was performed to validate the expression levels of DEmRNAs, DElncRNAs, and DEmiRNAs. Total RNA and small RNA were extracted from samples of CuR and CKR using an RNAprep pure Plant Kit (TIANGEN, Cat#DP432, China) and miRcute miRNA isolation kit (TIANGEN, Cat#DP501, China), respectively. First-strand cDNA was synthesized from 1 μg of total RNA with the HiScript® II Q RT SuperMix (Vazyme, Cat#R223, China) for qPCR of mRNA and with the lnRcute lncRNA First-Strand cDNA Synthesis Kit (TIANGEN, Cat#KR202, China) for qPCR of lncRNA. In addition, 1 μg of small RNA was used for cDNA synthesis using a miRNA 1st Strand cDNA Synthesis Kit (Vazyme, Cat#MR101, China) with the stem-loop primer designed by the stem-loop sequence (GTCGTATCCAGGGTCCGAGGTATTCGCACTGGATACGAC) except for the internal reference U6. qPCR was performed on the Bio-Rad CFX Connect RealTime system using ChamQ™ Universal SYBR® qPCR Master Mix (Vazyme, Cat#Q711), lnRcute lncRNA qPCR Detection Kit (TIANGEN, Cat#FP402) and miRNA Universal SYBR® qPCR Master Mix (Vazyme, Cat#MQ101) following the manufacturer’s instructions. The 2-ΔΔCT method was used to normalize and determine the RNA level relative to an internal reference gene, actin (Cs1g05000.1) or U6. All primers are included in Additional file 9 : Table S9.
Cfx connect realtime system
Manufactured by Vazyme
Sourced in China
The CFX Connect RealTime system is a real-time PCR detection system designed for accurate and reliable nucleic acid quantification. The system features a robust thermal cycler and high-performance optics for sensitive detection of fluorescent signals, enabling precise and reproducible gene expression analysis and qPCR assays.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Chamq universal sybr qpcr master mix, by Vazyme (3 mentions)
Rnaprep pure plant kit, by Tiangen Biotech (3 mentions)
Hiscript 2 q rt supermix, by Vazyme (2 mentions)
Lnrcute lncrna first strand cdna synthesis kit, by Tiangen Biotech (1 mentions)
Lnrcute lncrna qpcr detection kit, by Tiangen Biotech (1 mentions)
Mirna 1st strand cdna synthesis kit, by Vazyme (1 mentions)
Mircute mirna isolation kit, by Tiangen Biotech (1 mentions)
Mirna universal sybr qpcr master mix, by Vazyme (1 mentions)
Iscript cdna synthesis kit, by Bio-Rad (1 mentions)
Rna purification kit, by EZBioscience (1 mentions)
Fastking gdna dispelling rt supermix, by Tiangen Biotech (1 mentions)
Sybr green, by Vazyme (1 mentions)
4 protocols using cfx connect realtime system
1
Validating Differential Expression Profiles
2
qRT-PCR Analysis of CsATG Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the CK and stress-treated leaves or roots of “Hamlin” sweet orange seedlings using a RNAprep pure plant kit (Tiangen Biotech Co., Ltd., Beijing, China), and the RNA concentration and quality were determined with a Nanodrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). Then, 1 μg of high-quality RNA was used for cDNA synthesis with an iScript cDNA synthesis kit (Bio-Rad) according to the manufacturer’s instructions. qRT-PCR was performed on the Bio-Rad CFX Connect RealTime system using ChamQ Universal SYBR qPCR Master Mix (Vazyme Biotech Co., Ltd., Nanjing, China). Each PCR reaction contained 5.0 μL SYBR mix, 0.2 μM primers, and 1.0 μL diluted cDNA in a final volume of 10 μL. Specific primers of CsATG genes were designed using the online primer-blast program in the NCBI website, whereas Actin (Cs1g05000.1) was used as a reference gene to normalize the relative expression levels of the tested genes. Three biological replicates and three technical replicates were performed for each treatment.
3
Real-time qPCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using an RNA purification kit (EZBioscience, USA), and then used to synthesize cDNA with the FastKing gDNA Dispelling RT SuperMix (TIANGEN, China). Real-time qPCR was performed using SYBR Green (Vazyme, China), 96-well plates and the CFX connect Real-Time System. Each well was loaded with a total of 20 μL containing 2 μL of cDNA, 0.5 μL of target primers, 7.5 μL of water and 10 μL of SYBR Select Master Mix. Real-time qPCR was performed for 40 cycles, with each cycle consisting of denaturation for 15 s at 94°C, annealing for 30 s at 60°C and elongation for 30 s at 72°C. Relative quantification was done using the 2- ΔΔCT method. Expression was normalized against 18s. Mean expression levels of chow-fed mice were set as 100%. The primers used are shown below.
4
Pummelo Root Total RNA Extraction and RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the –Fe and CK roots of pummelo by using the RNAprep pure plant kit (Cat#DP432, Tiangen Biotech Co., Ltd., Beijing, China), and the RNA concentration and quality were determined with a Nanodrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). Then, 1 μg of high-quality RNA was used for cDNA synthesis with HiScript II Q RT Super Mix (Cat#R222–01, Vazyme Biotech Co., Ltd., Nanjing, China) according to the manufacturer’s instructions. qRT-PCR was performed on the Bio-Rad CFX Connect RealTime system by using ChamQ™ Universal SYBR® qPCR Master Mix (Cat#Q711, Vazyme Biotech Co., Ltd., Nanjing, China). Each PCR reaction contained 5.0 μL SYBR mix, 0.2 μM primers, and 1.0 μL diluted cDNA in a final volume of 10 μL. The 2-ΔΔCT method was used to normalize and calculate the expression level of each tested gene relative to an internal reference gene, actin (Cs1g05000.1). All the primers of CgbHLH genes are listed in Additional file 3 : Table S2. Three biological replicates and three technical replicates were performed for each treatment. The presented data herein are means ± standard errors (SE) of three biological replicates. Student’s t-test was used to analyze the statistical differences between -Fe and corresponding CK samples, taking P < 0.05 as significantly different.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!