Rneasy plus micro

Manufactured by Qiagen

Sourced in Germany

The RNeasy Plus Micro Kit is designed for the purification of total RNA, including small RNAs, from small samples such as cell lysates, biopsies, and laser-captured microdissected cells. The kit utilizes a silica-membrane-based technology to provide efficient and reliable RNA purification.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

RNeasy Plus Micro Kit (1707 citations) RNeasy Plus (85 citations) RNeasy Micro (65 citations) RNeasy Plus Mini or Micro Kit (14 citations) QIAGEN RNeasy Plus Micro RNA isolation kit (12 citations) RNeasy Plus Micro extraction kit (10 citations) RNeasy micro/mini plus kit (6 citations) RNeasy Plus Micro Kit (50) (5 citations) RNeasy Plus Micro columns (2 citations) RNeasy Plus Mini or Plus Micro kit (2 citations)

18 protocols using rneasy plus micro

RNA Isolation and mRNA Sequencing Workflow

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

For RNA isolation, isolated cells were quickly pelleted by centrifugation and immediately placed in RNA lysis buffer per protocol (Qiagen, RNeasy Plus Micro, Venlo, the Netherlands). Isolated RNA was quantified and sequencing libraries generated using low-input, mRNA sequencing DNA preparation kit per company protocol (Illumina, San Diego, California). Paired End-75 sequencing was performed on an Illumina HiSeq3000. Reads were trimmed to remove adapter sequences using Cutadapt v1.16 (8) and aligned to the GENCODE GRCm38.p5/human b37 genome using STAR v2.5.3a (9) (link). GENCODE vM12/Ensembl v75 gene annotations were provided to STAR to improve the accuracy of mapping. Quality control on both raw reads and adaptor-trimmed reads was performed using FastQC. FeatureCounts v1.15.2 (10) (link) was used to count the number of mapped reads to each gene. Differentially expressed, protein-coding genes were detected by DESeq2 (v1.18.1) (11) (link). Heatmap3 was used for cluster analysis and visualization (12) (link). Genome ontology analysis was performed on differentially expressed genes using the ToppGene suite. Gene set enrichment analysis (GSEA) was performed using the GSEA package (13) (link). The gene set for the EC-restricted gene list (n = 151) was obtained from a previously published curated dataset (14) .

Beckman J.A., Doherty S.P., Feldman Z.B., Banks E.S., Moslehi J., Jaffe I.Z., Hamburg N.M., Sheng Q, & Brown J.D. (2019). Comparative Transcriptomics of Ex Vivo, Patient-Derived Endothelial Cells Reveals Novel Pathways Associated With Type 2 Diabetes Mellitus. JACC: Basic to Translational Science, 4(5), 567-574.

+ Open protocol

+ Expand

RT-qPCR Analysis of Pdgfc Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Pdgfc expression was assessed in primary lung fibroblasts before immortalization. Lungs or tumors were homogenized in lysis buffer using a Precellys tissue homogenizer. RNA was isolated using Qiagen RNeasy Plus Micro (homogenized tissues) or RNeasy Plus Mini (cells) kits. cDNA was generated using the QuantiTect reverse transcriptase kit (Qiagen) or the SuperScript IV kit (Invitrogen) with random hexamers for overexpression lines. RT–qPCR was performed with Taqman Gene Expression Assay probes (Supplementary Table 3) on a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems, 1.7.1). Each reaction was performed in triplicate, and relative expression levels were normalized to B2m or B2M and/or Ipo8 or IPO8. When calculating the relative expression across independent cell lines, multiple house-keeping genes were used (B2m, Ipo8, Ubc and 18s).

Turrell F.K., Orha R., Guppy N.J., Gillespie A., Guelbert M., Starling C., Haider S, & Isacke C.M. (2023). Age-associated microenvironmental changes highlight the role of PDGF-C in ER+ breast cancer metastatic relapse. Nature Cancer, 4(4), 468-484.

+ Open protocol

+ Expand

Thymus CD62L+CD4+ Cell RNA Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

CD62L⁺CD4⁺ cells were isolated from the thymus, as described above, prior to RNA purification (RNeasy Plus Micro, QIAGEN). cDNA was generated using Superscript VILO cDNA synthesis kit (Life Technologies) and analyzed by a quantitative TaqMan RT-PCR method with the primers and probes designed by Universal ProbeLibarary Assay Design Center (Roche). S1pr1 primers; forward: CGGTGTAGACCCAGAGTCCT, reverse: AGCTTTTCCTTGGCTGGAG, Actb primers; forward: CTAAGGCCAACCGTGAAAAG, reverse: ACCAGAGGCATACAGGGACA. The expression values were normalized using Actb expression as endogenous controls.

Takeda A., Hossain M.S., Rantakari P., Simmons S., Sasaki N., Salmi M., Jalkanen S, & Miyasaka M. (2016). Thymocytes in Lyve1-CRE/S1pr1f/f Mice Accumulate in the Thymus due to Cell-Intrinsic Loss of Sphingosine-1-Phosphate Receptor Expression. Frontiers in Immunology, 7, 489.

+ Open protocol

+ Expand

Transcriptomic Profiling of Naïve T Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Naïve T cells were sorted from spleens collected from 21-week-old females. 5 × 10⁵ cells for each replicate were sorted by using BD FACSymphony S6 with a 70 μm nozzle. The fluorophore-conjugated antibodies and dilutions used for cell sorting are listed in Supplementary Table 19. Total RNA from sorted cells was isolated by using RNeasy plus micro (QIAGEN, 74034). 50 ng for each sample was used for the reverse transcription with barcoded primer BU3 (IDT; Supplementary Table 19) followed by the purification, second strand synthesis and tagmentation following the original BRB-seq protocol but using AMPure XP for purification^{31 (link)}. Tagmented library was amplified with P5_BRB and BRB_Idx7N5 primers (5 μL, Supplementary Table 19) using NEBNext UltraTM II Q5 Master Mix (NEB, M0544L) which was incubated at 98 °C for 30 sec before adding DNA with the following conditions: 72 °C 3 min, 98 °C for 30 sec, and 15 cycles of (98 °C for 10 sec, 63 °C for 30 sec, 72 °C 60 sec), 72 °C for 5 min. Libraries were sequenced by NextSeq 550 High Output with 21 bp for read 1 and 72 bp for read 2 (Illumina). Sequenced reads were aligned using STAR (v2.7.6a, --outFilterMultimapNmax 1)⁶⁴ followed by demultiplexing using BRB-seq Tools (v1.6)^{31 (link)}. For BRB-seq analysis, please see Supplementary Methods.

Mouri K., Guo M.H., de Boer C.G., Lissner M.M., Harten I.A., Newby G.A., DeBerg H.A., Platt W.F., Gentili M., Liu D.R., Campbell D.J., Hacohen N., Tewhey R, & Ray J.P. (2022). Prioritization of autoimmune disease-associated genetic variants that perturb regulatory element activity in T cells. Nature genetics, 54(5), 603-612.

+ Open protocol

+ Expand

RNA Extraction from PBMC Subsets

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from PBMC subsets at the University of Birmingham using the RNEasy Plus Micro and RNeasy Plus Mini Kits (Qiagen Ltd, Manchester, UK) for<500,000 and>500,000 sorted cells, respectively. As recommended, eluted RNA samples were stored at −80^°C until RNA-seq.

Mulcahy V., Liaskou E., Martin J.E., Kotagiri P., Badrock J., Jones R.L., Rushbrook S.M., Ryder S.D., Thorburn D., Taylor-Robinson S.D., Clark G., Cordell H.J., Sandford R.N., Jones D.E., Hirschfield G.M, & Mells G.F. (2023). Regulation of immune responses in primary biliary cholangitis: a transcriptomic analysis of peripheral immune cells. Hepatology Communications, 7(4), e0110.

+ Open protocol

+ Expand

Profiling Frozen Human Hepatocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Frozen primary human hepatocytes from healthy donors were purchased from BioIvt (Catalog number M00995-P, lot: SMC and AQL). After thawing in a 37 °C water bath, the hepatocytes were washed with Cryopreserved Hepatocyte Recovery Medium (CHRM, Thermo Fisher Scientific, CM7000). RNA from about 0.5 million cells were purified with RNeasy Plus Micro (QIAGEN). Around 50,000 cells were washed with PBS and subjected to tagmentation and ATAC-seq described below. About 5–10 million cells were crosslinked with 1% formaldehyde for ChIP-seq described below.

Ma H., de Zwaan E., Guo Y.E., Cejas P., Thiru P., van de Bunt M., Jeppesen J.F., Syamala S., Dall’Agnese A., Abraham B.J., Fu D., Garrett-Engele C., Lee T., Long H.W., Griffith L.G., Young R.A, & Jaenisch R. (2022). The nuclear receptor THRB facilitates differentiation of human PSCs into more mature hepatocytes. Cell stem cell, 29(5), 795-809.e11.

+ Open protocol

+ Expand

Retinal and Choroid RNA Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols

Retinal tissue (cleaned of vitreous and RPE) and SRIRS RPE RNA-containing pellets were dissolved in RLT Buffer (Qiagen), and total RNA was obtained using the column-based RNA purification kit, RNeasy Plus Micro (Qiagen). RNA from choroid/sclera tissue (empty eyecups following SRIRS RPE RNA extraction) was extracted using TRIzol reagent (Invitrogen) following supplier’s instructions. RNA concentration and quality were assessed using the RNA ScreenTape system (Agilent Technologies) and Quant-iT™ RiboGreen® RNA quantitation kit (Invitrogen).

Abcouwer S.F., Miglioranza Scavuzzi B., Kish P.E., Kong D., Shanmugam S., Le X.A., Yao J., Hager H, & Zacks D.N. (2024). The mouse retinal pigment epithelium mounts an innate immune defense response following retinal detachment. Journal of Neuroinflammation, 21, 74.

+ Open protocol

+ Expand

Extraction and Quantification of Total RNA from Sperm and Testes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs were extracted from the purified sperm (n = 4) and testes (n = 2) samples using RNeasy^® Plus Micro (Qiagen, Duesseldorf, Germany) according to the manufacturer’s instructions with some modifications. We added 1 ml of buffer RLT (a guanidine-thiocyanate lysis buffer supplemented with 10 mM DL-Dithiothreitol) to the sperm pellet and 10 mg testes tissues, and then homogenized the sample by passing the samples through a 20-G needle attached to a 1-ml syringe 10 to 15 times. After total RNA was bound to the membrane and other contaminants were efficiently washed away, on-column DNase digestion was performed to eliminate trace amounts DNA contamination. The concentration and integrity of the total RNA samples were evaluated using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific Inc., Wilmington, DE, USA) and a 2100-Bioanalyzer with the RNA 6000 Nano Chip (Applied Biosystems, Carlsbad, CA, USA), respectively.

Zhang X., Gao F., Fu J., Zhang P., Wang Y, & Zeng X. (2017). Systematic identification and characterization of long non-coding RNAs in mouse mature sperm. PLoS ONE, 12(3), e0173402.

+ Open protocol

+ Expand

Quantification of Tfh Cell Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was prepared from Tfh cells isolated from draining LNs on day 10 post first CII immunization with RNeasy Plus Micro (QIAGEN, Venlo, Netherlands) according to the instructions provided by the manufacturer. cDNA was obtained by reverse transcription with a commercially available kit (TaKaRa Bio, Otsu, Japan). A TaqMan Assay-on-Demand gene expression product was used for real-time PCR (Applied Biosystems, Foster City, CA, USA). The expression levels of IL21and Bcl6 were normalized relative to the expression of GAPDH. Analysis was performed with ABI Prism 7500 apparatus (Applied Biosystems).

Kondo Y., Yao Z., Tahara M., Iizuka M., Yokosawa M., Kaneko S., Segawa S., Tsuboi H., Yoh K., Takahashi S., Matsumoto I, & Sumida T. (2015). Involvement of RORγt-overexpressing T cells in the development of autoimmune arthritis in mice. Arthritis Research & Therapy, 17(1), 105.

+ Open protocol

+ Expand

Endothelial Cell RNA Isolation and RT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Prior to reverse transcription polymerase chain reaction (RT-PCR), total RNA from endothelial cell cultures was isolated using Total RNA Isolation System RNeasyPlus Micro (Qiagen, Germany), following manufacturer's instructions. The purity and amount of RNA were determined by measuring the OD at a ratio of 260 to 280 nm. One microgram of total RNA was transcribed into cDNA by Reverse Transcription System (Promega, Madison, WI, USA). For microRNA measurements, 5 ng of total RNA was reverse-transcribed using the TaqMan®MicroRNA Reverse Transcription Kit and miRNA-specific RT primers (Applied Biosystems).

Burja B., Kuret T., Janko T., Topalović D., Živković L., Mrak-Poljšak K., Spremo-Potparević B., Žigon P., Distler O., Čučnik S., Sodin-Semrl S., Lakota K, & Frank-Bertoncelj M. (2019). Olive Leaf Extract Attenuates Inflammatory Activation and DNA Damage in Human Arterial Endothelial Cells. Frontiers in Cardiovascular Medicine, 6, 56.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!