Log In Sign up
The largest database of trusted experimental protocols

Psi check2 luciferase reporter

Manufactured by Promega
Visit Supplier
Sourced in United States

The Psi-Check2 luciferase reporter is a tool used for monitoring and quantifying gene expression in cells. It consists of a firefly luciferase reporter gene that can be fused to a target sequence of interest, allowing for the measurement of transcriptional activity. The Psi-Check2 system provides a platform for functional analysis of regulatory elements and genetic interactions.

Automatically generated - may contain errors

Lab products found in correlation

Dual luciferase assay kit, by Promega (3 mentions) Dual luciferase reporter assay system, by Promega (2 mentions) Pgl3 basic vector, by Promega (2 mentions) Quickchange lightning kit, by Agilent Technologies (2 mentions) Xtremegene sirna, by Merck Group (2 mentions) Dual luciferase assay system, by Promega (1 mentions) Luciferase reporter system, by Promega (1 mentions) Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions) Dual luciferase reporter system, by Promega (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)

8 protocols using psi check2 luciferase reporter

1

Validating LINC00339 Promoter and miRNA Interactions

Check if the same lab product or an alternative is used in the 5 most similar protocols
The SP1 binding motif in the promoter region of LINC00339 was identified by JASPAR (http://jaspar.genereg.net/). The full-length and the different fragment sequences were synthesized and then cloned into the pGL3-basic vector (Promega, Madison, WI, USA). All vectors were verified by sequencing, and luciferase activities were assessed using the Dual Luciferase Assay Kit (Promega).
LINC00339 and MED19 wild type (wt) with potential miR-378a-3p binding sites or mutants of each site (mut) were amplified and cloned into the psi-CHECK-2 luciferase reporter (Promega). HCT-116 cells were seeded in a 24-well plate and grown to 80% confluence. The cells were then cotransfected with luciferase reporters and miR-378a-3p or the negative control. After 48 h of transfection, luciferase activity was tested using a Dual-Luciferase Reporter Assay System (Promega).
Ye H., Li W., Wu K., Liu Y., Lv Y., Zhu Y., Luo H, & Cui L. (2020). The SP1-Induced Long Noncoding RNA, LINC00339, Promotes Tumorigenesis in Colorectal Cancer via the miR-378a-3p/MED19 Axis. OncoTargets and therapy, 13, 11711-11724.
+ Open protocol
+ Expand
2

Luciferase Assay of miR-30b-3p Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The wild-type fragment of CERS6-AS1 or MDM2 containing putative miR-30b-3p binding site and the mutant fragment of CERS6-AS1 or MDM2 were synthesized and cloned into the psiCHECK-2 luciferase reporter (Promega, Madison, WI, USA). By using Lipofectamine 3000, the negative control or overexpression of miR-30b-3p was co-transfected in HepG2 and MHCC97H cells together with the appropriate luciferase reporter construct. After 48 h, Renilla and firefly luciferase activities were measured via a Dual-luciferase Assay System (Promega, USA).
Xu B., Wei Y., Liu F., Li L., Zhou S., Peng Y, & Li B. (2022). Long noncoding RNA CERS6-AS1 modulates glucose metabolism and tumor progression in hepatocellular carcinoma by promoting the MDM2/p53 signaling pathway. Cell Death Discovery, 8, 348.
+ Open protocol
+ Expand
3

Luciferase Assay for NRP2 3'UTR

Check if the same lab product or an alternative is used in the 5 most similar protocols
The MDA-MB-231 cells were seeded onto 24-well plates (5.0×104cells/well) and allowed to adhere overnight. The following day, the cells were transiently transfected using transfection reagent using Lipofectamine 2000 reagent (Invitrogen) with pGL3–X-baI (Promega) and 100 ng/well psi-Check2 luciferase reporter (Promega) that housed the 3′UTR sequence that contained either a wild-type or mutant version of the NRP2 seed sequence and transfected into MDA-MB-231 cells in the presence of a miR-196a-3p mimic or its control. The Renilla luciferase activities were measured by the Luciferase Reporter System (Promega, Madison, WI, USA) at 2 days after transfection.
Chen Y., Huang S., Wu B., Fang J., Zhu M., Sun L., Zhang L., Zhang Y., Sun M., Guo L, & Wang S. (2017). Transforming growth factor-β1 promotes breast cancer metastasis by downregulating miR-196a-3p expression. Oncotarget, 8(30), 49110-49122.
+ Open protocol
+ Expand
4

miRNA Regulation of JPX and CXCR6

Check if the same lab product or an alternative is used in the 5 most similar protocols
StarBase 2.0 (http://starbase.sysu.edu.cn) was used to predict the potential miRNAs that can bind to JPX. Wild-type (WT) and mutant (MUT) JPX sequences, as well as WT and MUT CXCR6 sequences, were designed by Shanghai GenePharma Co., Ltd. and cloned into the psiCHECK2 luciferase reporter (Promega Corporation). NCI-N87 cells transfected with 10 nM miR-197 mimics and 10 nM NC were prepared as single cell suspensions in serum-free DMEM at a density of 1×105 cells/ml. Cells were seeded in 6-well plates (1 ml cell suspensions per well). NCI-N87 cells were transfected with WT and MUT JPX psiCHECK2 luciferase reporters, as well as WT and MUT CXCR6 psiCHECK2 luciferase reporters. Transfection was performed using Lipofectamine 2000. At 48 h post-transfection, the luciferase activity of each well was determined using a Dual-luciferase reporter assay system (Promega Corporation) according to the manufacturer's protocol. The relative luciferase activity of each well was normalized to Renilla luciferase activity.
Han X, & Liu Z. (2020). Long non-coding RNA JPX promotes gastric cancer progression by regulating CXCR6 and autophagy via inhibiting miR-197. Molecular Medicine Reports, 23(1), 60.
+ Open protocol
+ Expand
5

NEDD4L 3'UTR Reporter Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
The RBP-Jk reporter plasmid was acquired from SABiosciences (a Qiagen company). The reporter was transfected with Xtremegene siRNA (Sigma Aldrich), and 48hr lysates were analyzed using the dual luciferase assay kit (Promega, Madison, WI, USA). RBP-jK luciferase are representative experiments from two reproducible experiements for each cell lines, and show technical replicates of 3. For 3′UTR experiments, the 3′UTR of NEDD4L was cloned into the psi-Check2 luciferase reporter (Promega), and transfection and analysis was performed as above. The miR mimics with UTR experiment was reproduced twice, with representative experiment shown in Figure 4D. Figure 4E was reproduced three times, with representative experient shown. To mutate the three microRNA binding sites in the NEDD4L 3′UTR we performed site directed mutagenesis using the QuickChange Lightning kit (Agilent Technologies, Santa Clara, CA, USA) and the following oligonucleotide sequences: gcaaaagtctgttaggcaaatgcaatatttcaagcagaacttgcttgaagaacaa, tgttgtaaatgcaccaattctgaaggaaatatatgtactacatggaggtcatatctg, ccagattcacaattgatagatacttctccggaaagatgtgtgcagggaa.
Guarnieri A., Towers C., Drasin D., Oliphant M., Andrysik Z., Hotz T., Vartuli R., Linklater E., Pandey A., Khanal S., Espinosa J, & Ford H. (2018). The miR-106b-25 cluster mediates breast tumor initiation through activation of NOTCH1 via direct repression of NEDD4L. Oncogene, 37(28), 3879-3893.
+ Open protocol
+ Expand
6

Luciferase Assay for miR-646 Regulation of CircRNA CCND1 and CCND1-3'UTR

Check if the same lab product or an alternative is used in the 5 most similar protocols
The full‐length sequence of circ‐CCND1 or CCND1‐3′‐UTR with wild‐type or mutant miR‐646 binding site was cloned into psiCHECK2 luciferase reporter (Promega) and named as Luc‐circ‐CCND1‐WT (5′‐AGCUGCU‐3′), Luc‐circ‐CCND1‐Mut (5′‐UCGACGA‐3′), Luc‐CCND1‐3′‐UTR‐WT (5′‐AGCUGCU‐3′) and Luc‐CCND1‐3′‐UTR‐Mut (5′‐AGCUGCU‐3′), respectively. The above vectors were cotransfected with control or miR‐646 mimics into Hep‐2 and TU212 cells using Lipofectamine 3000 (Invitrogen). After 48 hours, the luciferase activity was detected by a dual‐luciferase reporter system (Promega).
Zang Y., Li J., Wan B, & Tai Y. (2020). circRNA circ‐CCND1 promotes the proliferation of laryngeal squamous cell carcinoma through elevating CCND1 expression via interacting with HuR and miR‐646. Journal of Cellular and Molecular Medicine, 24(4), 2423-2433.
+ Open protocol
+ Expand
7

HSPA5 Promoter and RAB27A 3'-UTR Regulation

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
A 268 bp sequence of the HSPA5 promoter containing a putative STAT1 binding sequence (ttcctggaat) or mutated target sequence (aacgtctctt) was synthesized and directly subcloned into the pGL3 basic vector (Promega, Madison, WI, USA). The constructed and pRL-TK plasmids were co-transfected into HEK293T cells for 48 h before the cells were harvested, and the luciferase activity was examined with a Dual Luminescence Assay Kit (Promega).
To analyze the regulation of miR-124 on RAB27A, a 235 bp fragment containing the predicted miR-124 binding sites from the RAB27A 3’-UTR was synthesized and subcloned into the psiCHECK-2 luciferase reporter (Promega) to generate psiCHECK-2- RAB27A-3’-UTR wild-type or psiCHECK-2- RAB27A-3’-UTR mutant plasmids. A549, H1299, and H226 cells were transfected with wild-type or mutant plasmids using Lipofectamine 2000 (Life Technologies) for 48 h. The luciferase activity was evaluated as previously described39 (link).
Zeng Y., Zhao J., Wu Z., Huang Y., Wang A., Zhu J., Xu M., Zhang W., Zhang X., Li J., Huang J.A, & Liu Z. (2024). Targeting TYK2 alleviates Rab27A-induced malignant progression of non-small cell lung cancer via disrupting IFNα-TYK2-STAT-HSPA5 axis. NPJ Precision Oncology, 8, 74.
+ Open protocol
+ Expand
8

NEDD4L 3'UTR Reporter Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
The RBP-Jk reporter plasmid was acquired from SABiosciences (a Qiagen company). The reporter was transfected with Xtremegene siRNA (Sigma Aldrich), and 48hr lysates were analyzed using the dual luciferase assay kit (Promega, Madison, WI, USA). RBP-jK luciferase are representative experiments from two reproducible experiements for each cell lines, and show technical replicates of 3. For 3′UTR experiments, the 3′UTR of NEDD4L was cloned into the psi-Check2 luciferase reporter (Promega), and transfection and analysis was performed as above. The miR mimics with UTR experiment was reproduced twice, with representative experiment shown in Figure 4D. Figure 4E was reproduced three times, with representative experient shown. To mutate the three microRNA binding sites in the NEDD4L 3′UTR we performed site directed mutagenesis using the QuickChange Lightning kit (Agilent Technologies, Santa Clara, CA, USA) and the following oligonucleotide sequences: gcaaaagtctgttaggcaaatgcaatatttcaagcagaacttgcttgaagaacaa, tgttgtaaatgcaccaattctgaaggaaatatatgtactacatggaggtcatatctg, ccagattcacaattgatagatacttctccggaaagatgtgtgcagggaa.
Guarnieri A., Towers C., Drasin D., Oliphant M., Andrysik Z., Hotz T., Vartuli R., Linklater E., Pandey A., Khanal S., Espinosa J, & Ford H. (2018). The miR-106b-25 cluster mediates breast tumor initiation through activation of NOTCH1 via direct repression of NEDD4L. Oncogene, 37(28), 3879-3893.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!