Oligo dt 20 primer

QuickPrep Total RNA Extraction Kit (Amersham Biosciences, Tokyo, Japan) was used in the total RNA extraction. 1 μg of total RNA was used in the cDNA synthesis using oligo(dT)20 primer (Toyobo) and a ReverTra Ace-α First-strand cDNA Synthesis Kit (Toyobo).

Total RNAs were extracted from pancreas with the Trizol Reagent (Life Technologies, Carlsbad, CA), and cDNAs were synthesized using ReverTra Ace and oligo d(T)20 primer (TOYOBO, Osaka, Japan). Densitometric analysis of RT-PCR for Ins1 and Ins2 was performed with ImageJ software and normalized by the β-actin amplification level of the respective sample. Entire coding sequences of Ins1 and Ins2 genes were sequenced with amplified cDNA fragments. Genomic DNAs were extracted from blood using the ZymoBead Genomic DNA Kit (Zymo Research, Irvine, CA). All exon and exon/intron boundaries of the Hnf1β gene were amplified from genomic DNA and sequenced.

wild-type wt1: total RNA from a male frog kidney was extracted, and cDNA was synthesized using oligo (dT) primer (Oligo(dT)20 Primer, Toyobo, Osaka, Japan) and reverse transcriptase (PrimeScript Reverse Transcriptase, Takara Bio, Tokyo, Japan). Using this cDNA as a template, WT1.L protein coding sequence was PCR amplified using the following primer sets; 5′ GGCTCGAGATGGGATCTGATGTGCGG 3′ (the underline represents XhoI site for subcloning) and 5′ GGGCTAGCCTAAAGGGCCAGATGGAGTT 3′ (the underline represents NheI site for subcloning), and subcloned into the XhoI/NheI digested pCS4-3HA vector. The nucleotide sequence of the resultant plasmid was confirmed by sequencing. This construct was linearized by NotI, and mRNA was transcribed by SP6 RNA polymerase (mMESSAGE mMACHINE™ SP6 Transcription Kit, Thermo Fisher Scientific, MA, USA).
vp16-wt1 and en-wt1: the four-zinc finger DNA binding domain sequence from the wild-type wt1 gene was PCR amplified using the following primer set; 5′ GGCTCGAGAGAGGAATTCAAGATGTGAG 3′ (the underline represents XhoI site for subcloning) and 5′ GGGCTAGCCTAAAGGGCCAGCTGGAGAA 3′ (the underline represents NheI site for subcloning). The PCR products were subcloned into XhoI/NheI digested pCS4-HA-VP16 or pCS4-3HA-En vector. Synthesis of mRNA from these constructs was performed in the same manner as described above.

Total RNA was isolated from cell pellets using RNeasy^® Mini Kit (Qiagen, California, USA) as described by the manufacturer's protocol. One μg of total RNA was reverse-transcribed with Oligo(dT)₂₀ Primer (Toyobo Co., Osaka, Japan) and ReverTra Ace^® (Toyobo Co.). The qRT-PCR was conducted using THUNDERBIRD^® SYBR^® qPCR mix (Toyobo Co.) in a LightCycler^® 2.0 (Roche Applied Science). All reactions were performed in triplicate. The relative amount of mRNA was normalized against Actb. The primers used are listed in the Supplementary Table 3.

To prepare total RNA, Sepasol (Nacalai Tesque) was added to BV-2 cells and the right striatum of each mouse was injected with LPS, and RNA fractions were extracted by following protocol. Complementary DNA (cDNA) was prepared by reverse transcriptional reaction using ReverTraAce and an oligo (dT)₂₀ primer (Toyobo Life Science, Inc., Tokyo, Japan). The expression of interested gene expression was analyzed by quantitative real-time PCR using an ABI 7300 thermal cycler and Luna Universal qPCR Master Mix (New England Biolabs, Ipswich, MA, USA) as previously described [32 (link)]. The PCR primer sequences were as follows: iNOS 5′-TCTGCGCCTTTGCTCATGAC-3′(Upstream) and 5′-TAAAGGCTCCGGGCTC-3′ (downstream); IL-6 5′-CCACTTCACAAGTCGGAGGC-3′ (Upstream) and 5′-GGAGAGCATTGGAAATTGGGGT-3′ (downstream); TNFα 5′-TACTGAACTTCGGGGTGATCGG-3′ (Upstream) and 5′-CAGCCTTGTCCCTTGAAGAGAA-3′ (downstream); CCL2 5′-TGAGGTGGTTGTGGAAAAGG-3′ (Upstream) and 5′-CCTGCTGTTCACAGTTGCC-3′ (downstream); CXCL1 5′-GCCTATCGCCAATGAGCTG-3′ (Upstream) and 5′-TGGGGACACCTTTTAGCATC-3′ (downstream); COX-2 5′-AGAAGGAAATGGCTGCAGAA-3′ (Upstream) and 5′-GCTCGGCTTCCAGTATTGAG-3′ (downstream); GAPDH 5′-ACTCCACTCACGGCAAATTC-3′ (Upstream) and 5′-CCTTCCACAATGCCAAAGTT-3′ (downstream). The expression of GAPDH mRNA was utilized as an internal control.

RNA was prepared using Sepazol (Nacalai Tesque). RT was performed using an oligo (dT)₂₀ primer (TOYOBO, Osaka, Japan) and 1 μg of total RNA for first-strand cDNA synthesis, as described previously [18 (link)]. Quantitative real-time PCR was performed using an iCycler detection system (Bio-Rad, Berkeley, CA, USA). PCR was performed in a volume of 25 μL with KAPA SYBR® FAST qPCR Kits (KAPA Biosystems, Wilmington, MA, USA). The PCR primer sequences used were as follows: PEPCK, 5′- ATCCCCAAAACAGGCCTCAG -3′ (forward) and 5′-ACGTACATGGTGCGACCTT-3′ (reverse); GAPDH, 5′- ACCACAGTCCATGCCATCAC-3′ (forward) and 5′- TCCACCACCCTGTTGCTGTA-3′ (reverse).