Power tools software

The microarray hybridization and analysis were performed in a previously published study by Lake et. Al.^{18 (link)} Briefly, Affymetrix GeneChip Human 1.0 ST Arrays (Affymetrix, Santa Clara, CA) were used and 33,252 genes were analyzed for differential expression. Affymetrix® Power Tools software was employed to generate gene-level and exon-level expression signal estimates from CEL files using a multiarray mathematical algorithm. The data are publicly available at ArrayExpress public repository for microarray data under the accession number E-MEXP-3291 (http://www.webcitation.org/5zyojNu7T).

MACS purified CD11c⁺ cells from spleens of allo-HSCT recipients on day 7 or untreated mice were placed directly into TRIzol LS (Invitrogen). mRNA was isolated, amplified, and hybridized to an Affymetrix GeneChip (MOE430A). Affymetrix Power Tools software was used for processing and quantile normalization of fluorescence hybridization signals by the robust multichip averaging method (Irizarry et al., 2003 (link)). Transcripts were log₂-normalized and average values for technical replicates were obtained for analysis of change in expression using Significance Analysis of Microarray (SAM). Differential gene expression was assessed using the Bioconductor package “siggenes” with a fold change cutoff of >2. Full results, including p-values and multiple-testing corrected q-values, are included in Supplementary Table 2. The Broad Institute GSEA software was used for gene-set enrichment analysis as previously described (Subramanian et al., 2005 (link)). Primers for Laptm5: Forward-GCGGTAAAGTGTCCTGTAGGTTC; Reverse- TCTTGACCACGCCGAACAGCAG:

CD8⁺ T cells were enriched with magnetic beads and CD45.2 OT1 CD8⁺ T cells were sorted on a FACSAria (BD Biosciences). RNA was isolated using TRIzol (Invitrogen) according to the manufacturer's instructions. RNA was processed, amplified, labeled, and hybridized to Affymetrix GeneChip MoGene 1.0 ST microarrays (Santa Clara, CA) at the Molecular Profiling Facility of the University of Pennsylvania. Human CMV-specific (HLA-A*0201-NLVPMVATV or HLA-B*0702-TPRVTGGGAM tetramer-positive) CD8⁺ T cells were purified from PBMC obtained from subjects with persistent HCV viremia (infected for > 1year) or from healthy volunteers who were recruited at Massachusetts General Hospital in Boston (Table S1). The study was approved by the local IRB (Protocol # 1999-P-004983/54; MGH #: 90-7246). RNA was isolated, processed, amplified, labeled, and hybridized to Affymetrix Human Gene 1.0 ST microarrays. Affymetrix Power Tools software (Santa Clara, CA) was used to process and quantile normalize fluorescent hybridization signals using the Robust Multichip Averaging method (Irizarry et al., 2003 (link)). Transcripts were log₂ normalized. Hierarchical Clustering was performed with Gene Pattern (Reich et al., 2006 (link)) and Gene Set Enrichment Analysis was performed with GSEA software (Subramanian et al., 2005 (link)).