Proteins were isolated by lysing the cells with RIPA buffer (150 mM sodium chloride, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris, 1% PMSF, and a cocktail inhibitor for proteases and phosphatases), and the concentration of protein was determined by the BCA assay kit (Solarbio, Beijing, China). After SDS-PAGE separation, protein was transferred to a PVDF membrane (Millipore, Burlington, MA, USA). The PVDF membrane was blocked with 0.5% BSA for 2 h, and then incubated with the primary antibody for 2 h at room temperature. After TBST wash, the PVDF membrane was incubated with the corresponding horseradish peroxidase (HRP)-conjugated secondary antibody for 2 h at room temperature. The membrane was visualized by ECL plus (Bio-rad, Hercules, CA, USA) and examined with G:BoxChemiXL1.4 (Syngene, Cambridge, UK).
G box chemi xl1
Manufactured by Syngene
Sourced in United States
The G:BOX Chemi XL1.4 is a gel documentation and imaging system designed for capturing and analyzing chemiluminescent, fluorescent, and colorimetric signals. It features a high-resolution camera, interchangeable emission filters, and adjustable UV and white light transillumination.
Automatically generated - may contain errors
Lab products found in correlation
Hybond, by Cytiva (2 mentions)
Ecl plus, by Bio-Rad (1 mentions)
Pvdf membrane, by Merck Group (1 mentions)
Bca assay kit, by Solarbio (1 mentions)
Gapdh, by Abcam (1 mentions)
Gapdh, by Syngene (1 mentions)
Microson xl 2000, by Qsonica (1 mentions)
Total mtor, by Cell Signaling Technology (1 mentions)
Ecl system, by GE Healthcare (1 mentions)
Mini protean system, by Bio-Rad (1 mentions)
Hybond ecl, by GE Healthcare (1 mentions)
Bca protein assay kit, by Thermo Fisher Scientific (1 mentions)
Pro prep protein extraction solution, by iNtRON Biotechnology (1 mentions)
Pierce bca protein assay kit, by Thermo Fisher Scientific (1 mentions)
Np 40, by Merck Group (1 mentions)
Phenylmethylsulfonyl fluoride, by Merck Group (1 mentions)
Amersham ecl, by Cytiva (1 mentions)
Ecl detection reagent, by GE Healthcare (1 mentions)
Bovine serum albumin (bsa), by Thermo Fisher Scientific (1 mentions)
Protease and phosphatase inhibitor cocktail, by Merck Group (1 mentions)
8 protocols using g box chemi xl1
1
Protein Isolation and Western Blot Analysis
2
Western Blot Analysis of Myocardial Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Protocols were adapted from our previous work [28] (link). In brief, frozen myocardium tissue was ground in liquid nitrogen. Then ≅50 mg myocardium tissue powder was lysed in 500 µl lysis buffer containing 1∶100 protease inhibitor cocktail, 2 mM Na3VO4 and 10 mM NaF. Samples were sonicated (MicrosonTM XL-2000, Qsonica LLC. Newtown, CT, USA) and centrifuged at 14,000 g for 30 min. Supernatant protein concentrations were measured (Bio-Rad Laboratories (S) Pte Ltd, Singapore) and 25 µg of each sample was loaded onto 5 to 14% SDS-PAGE gels and electrophoresed. After over-night transfer at 30 V (4°C), membranes were immunoblotted with antibodies recognizing (i) p-Akt (Ser473), (ii) p-Akt (Thr308), (iii) total Akt, (iv) p-PTEN(Ser380/Thr382/383), (v) total PTEN, (vi) PDK1, (vii) PP2A, (viii) p-Bim (Ser69), (ix) total Bim, (x) Bcl-2, (xi) Bax, (xii) p-mTOR (Ser2448), and (xiii) total mTOR (Cell Signaling Technology, Research Biolabs Pte Ltd, Singapore), and (xiv) PHLPPL (Santa Cruz Biotechnology Inc., TWC BIO Pte Ltd, Singapore). GAPDH (Abcam, Abcell Pte Ltd, Singapore) was used as loading control. The chemiluminescence signal was captured with G:Box Chemi XL 1.4 (Syngene, Insta BioAnalytik Pte Ltd, Singapore), intensity was calculated with ImageJ software (www.imagej.nih.gov ) and protein expression was normalized to total Akt, PTEN, Bim, Bcl-2, mTOR or GAPDH.
3
Western Blot Analysis of Arterial Proteins
4
Quantitative Western Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cell lysates were prepared on ice in PRO-PREP Protein Extraction Solution (iNtRON Biotechnology, Gyeonggi-do, Korea) containing a protease/phosphatase inhibitor cocktail (GeneDEPOT, Barker, TX, USA). The protein concentration was determined using a Pierce™ BCA Protein Assay Kit (Thermo Fisher, Waltham, MA, USA). The cell lysates (30 μg) were separated on 8–15% SDS–polyacrylamide gel and transferred to the PVDF membrane. The membranes were incubated with appropriate primary antibodies in Tris-buffered saline with 0.1% Tween 20 (TBST) containing 3% BSA. The sources and working dilutions of the antibodies are summarized in Supplementary Table S1 . The bands on the PVDF membrane were detected with G:BOX Chemi XL1.4 (Syngene, Frederick, MD, USA) using EzWestLumi plus (ATTO, Tokyo, Japan) and the band intensities were quantified using the ImageJ program. All uncropped scans of Western blots are shown in the Supplementary Information .
5
Western Blot Analysis of THP-1 Cell Lysates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
THP-1 cells were lysed in protein lysis solution containing 10 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.5 mM EDTA, 0.5% (v/v) NP-40 (Merck), 1 mM phenylmethylsulfonyl fluoride (Merck) with freshly added 1X cOmplete EDTA-free protease inhibitor cocktail solution (Merck). Whole cell lysates were then separated on 10–15% SDS-PAGE gels and transferred to Hybond ECL nitrocellulose membranes (Merck). The membranes were blocked with 5% (w/v) non-fat dry milk in Tris-buffered saline (TBS) containing 0.1% (v/v) Tween 20 (TBST) for 1–2 h. The membranes were then incubated with diluted primary antibody in 5% (w/w) non-fat dry milk—TBST at 4 °C overnight. The primary antibodies and dilutions are listed in Supplemental Table S1 . After washing three times for 5–10 min with TBST, the membranes were incubated with the corresponding secondary antibody as listed in Supplemental Table S1 , at room temperature for 2 h, followed by three 10 min washes with TBST. The chemiluminescent signal was developed on membranes using Amersham ECL Select Western Blotting Detection Reagent (Merck) to detect the respective proteins, and images were obtained with G:Box ChemiXL1.4 (Syngene, Bangalore, India). Densitometric analyses were performed using Fiji software [60 (link)].
6
Western Blot Analysis of Protein Targets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total protein in the cells was extracted with radioimmunoprecipitation (RIPA) lysate premixed with phenylmethylsulfonyl fluoride (PMSF). After separating with 10% SDS-PAGE gel, transferring the isolated proteins on a PVDF membrane, and then blocked with 5% skim milk in TBST buffer. And then incubated separately in antibody at 4 °C overnight (Anti-MET Antibody, Bioss, 1:1000 dilution; Anti-TBL1XR1 Antibody, Bioss, 1:1000 dilution; Anti-p-Pi3k, CST, 1:1000 dilution; Anti-p-Akt Antibody, CST, 1:1000 dilution; Anti-GAPDH antibody, CST, 1:1000 dilution). The bands were washed 3 times with TBST solution for 10 min each time, and then incubated with the appropriate HRP-conjugated antibody (Abcam, 1:2000 dilution) on the shaker for 2 h at room temperature. Finally, the musical groups were cleansed using TBST solution strips on the shaker. The strips were then subjected to exposure in an exposure machine, utilizing the GBOX-chemi-XL1.4 from SYNGENE.
7
Gastrocnemius Muscle Protein Analysis
8
Transcriptional analysis of Nrg1 in HMVEC cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After appropriate treatments, total cellular RNA was isolated from HMVEC using Trizol reagent as per manufacturer’s instructions (Life Technologies). Reverse transcription was performed with the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) following the supplier’s protocol. The cDNA was used as a template for polymerase chain reaction (PCR) using specific primers. The primers used are as follows: human Nrg1, 5′-GACCTCTACTTCTCGTGACA-3′ (forward) and 5′- TCCAATCTGTTAGCAATGTG -3′ (reverse); human β-actin, 5′- TCTAGGCACCAAGGTGTG-3′ (forward), and 5′-TCATGAGGTAGTCCGTCAGG-3’ (reverse). The PCR performed on T-100 thermal cycler (Bio-Rad, Hercules, CA). The amplified RT-PCR products were separated on 1.6% (w/v) agarose gels and stained with ethidium bromide, pictures were captured using G:BOX Chemi XL1.4 (Syngene, Frederick, MD).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!