To express the SET domain proteins, putative active domains of CpSET8 (aa residues 402–556) was de novo synthetized and cloned into the bacterial expression vector pET15b at the NdeI and BamHI cloning sites which follows N-terminal 6x histidine tag sequence (Gencust, Boynes, France). The expression plasmid was amplified in E. coli BL21 (DE3) cells. After induction with 0.1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) at 16°C for 16 h, the cells were collected by centrifugation. The cell pellets were resuspended in lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10 mM Imidazole, 1x protease inhibitor, 1 mg/ml lysozyme, 5 µg/ml DNAse). The suspension was sonicated on ice. After centrifugation, the pellet was homogenized in denaturing solubilization buffer (50 mM Na2HPO4 pH 8.0, 300 mM NaCl, 8 M urea). The supernatant was subjected to Protino® Ni-IDA column (Macherey-Nagel, Germany). The his-tagged CpSET8 was eluted using denaturing elution buffer (50 mM Na2HPO4 pH 8.0, 300 mM NaCl, 8 M urea, 250 mM imidazole).
Protino ni ida column
Manufactured by Macherey-Nagel
Sourced in Germany
The Protino Ni-IDA column is a chromatography column designed for the purification of histidine-tagged recombinant proteins. It utilizes immobilized nickel-nitrilotriacetic acid (Ni-IDA) as the affinity ligand to capture and purify the target proteins. The column provides a simple and efficient method for the purification of histidine-tagged proteins from complex mixtures.
Automatically generated - may contain errors
Lab products found in correlation
Anti flag m2 magnetic bead, by Merck Group (1 mentions)
Ni2 hitrap chelating columns, by GE Healthcare (1 mentions)
Hitrap, by Cytiva (1 mentions)
Superdex 200 column, by GE Healthcare (1 mentions)
Anti v5 antibody, by Thermo Fisher Scientific (1 mentions)
Zeba desalting column, by Thermo Fisher Scientific (1 mentions)
Glutathione sepharose, by GE Healthcare (1 mentions)
6 protocols using protino ni ida column
1
Cloning and Purification of CpSET8 Protein
2
GlnZ Protein Interactome Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of six independent assays were considered for the analyses. In four assays, proteins were allowed to interact with GlnZ in the presence of ATP and were eluted in the presence of ATP plus 2-OG (namely, ATP1 to ATP4). In two assays, proteins were allowed to interact with GlnZ in the presence of ADP and were eluted in the presence of ATP plus 2-OG (namely, ADP1 and ADP2).
Assays ATP1 and ATP2 were performed using Ni2+ HiTrap chelating columns (GE Healthcare), assay ATP3 was performed using Protino Ni-IDA column (Macherey-Nagel), and assay ATP4 was performed using anti-FLAG M2 magnetic beads (Sigma-Aldrich). The rationale of using different chromatographic matrices was to discard proteins that could be enriched due to spurious affinity to the matrix. Both ADP1 and ADP2 assays were performed using Ni2+ HiTrap chelating columns (GE Healthcare).
Proteins eluted from His-tagged GlnZ Ni2+ affinity columns or FLAG-tagged GlnZ affinity columns were analyzed by label-free LC-MS/MS as described previously (61 (link)) (details inText S1 ).
Assays ATP1 and ATP2 were performed using Ni2+ HiTrap chelating columns (GE Healthcare), assay ATP3 was performed using Protino Ni-IDA column (Macherey-Nagel), and assay ATP4 was performed using anti-FLAG M2 magnetic beads (Sigma-Aldrich). The rationale of using different chromatographic matrices was to discard proteins that could be enriched due to spurious affinity to the matrix. Both ADP1 and ADP2 assays were performed using Ni2+ HiTrap chelating columns (GE Healthcare).
Proteins eluted from His-tagged GlnZ Ni2+ affinity columns or FLAG-tagged GlnZ affinity columns were analyzed by label-free LC-MS/MS as described previously (61 (link)) (details in
3
Recombinant PhaCAq protein production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The gene encoding PhaCAq was amplified by PCR using primers containing the NdeI and BamHI restriction sites, with a His-tag sequence inserted before the stop codon. The PCR product was ligated into the pET-21a vector (Novagen), and transformed into Escherichia coli BL21(DE3). The cells were grown in LB medium supplemented with 100 µg/ml ampicillin at 37 °C, and expression was induced with a final concentration of 100 µM isopropyl-β-D-thiogalactopyranoside (IPTG) when the OD600 reached 0.6. After seven hours of incubation at 25 °C, the cells were harvested by centrifugation and resuspended in 50 mM Tris-HCl, 300 mM NaCl, 5% glycerol, pH 7.4, lysed by sonication and centrifuged to remove cell debris. The supernatant was loaded onto a Ni 2+ -charged Protino Ni-IDA column (Macherey-Nagel), and PhaCAq was eluted stepwise with up to 1.0 M imidazole. The Ni 2+ affinity chromatography was repeated twice, followed by size-exclusion chromatography on a Superdex 200 column (GE Healthcare). Protein concentration was determined using the Bradford assay.
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
The copyright holder for this preprint (which this version posted January 29, 2018. ; https://doi.org/10.1101/235556 doi: bioRxiv preprint 5
was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
The copyright holder for this preprint (which this version posted January 29, 2018. ; https://doi.org/10.1101/235556 doi: bioRxiv preprint 5
4
Recombinant ES14.2 Protein Production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The protein used for the detection of antibodies against C. oncophora was a 14.2 kDa ES protein described previously by Poot et al. [31 (link)]. A codon optimised (E. coli) version of the open reading frame (ORF) was synthesised in vitro (SynthesisGene®; China). The ORF was amplified using the forward primer (5′-CAC CAA TGA ATA TAC CGA TGC ACT GGC AAA ATG TAC-3′) and reverse primer (5′-TTA TTC CCA ATA CAG ACA CAG AAC TTT CAG TT-3′). PCR products were cloned into the pET151 TOPO expression vector (Life Technologies). A Rosetta gami® (Novagene) E. coli clone containing the pET151/CoES14.2 was cultured at 37 °C until OD600nm reached 0.6. Synthesis of the ES14.2-V5-6 × His protein was induced with 0.5 mM isopropylthio-galactoside (IPTG) at 37 °C for 4 h. The recombinant ES14.2-V5-6 × His protein was purified from inclusion bodies using Protino® Ni-IDA columns (Macherey-Nagel, Germany) according to the manufacturer’s protocol. An additional wash step using a 50 mM concentration of imidazole and 2 % Tween20 was conducted before elution with 250 mM imidazole. Purity of the eluted protein was analysed on 12 % SDS–PAGE, stained with GelCode™ colloidal coomassie stain (ThermoFisher). Western blotting using an anti-V5 antibody (Life Technologies) was carried out to confirm that the target protein was obtained.
5
Purification of Clostridium Difficile Toxins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GST–CDTa, GST–CDTaN–TcdB1–543 and GST–CDTb were expressed in Escherichia coli following a standard protocol. Gene expression was induced by 100 µM isopropyl-β-d -thiogalactopyranosid when the bacterial cultures reached an OD600 of 0.6. The GST fusion proteins were affinity purified via glutathione-sepharose (GE Healthcare, Dornstadt, Germany) by gravity flow, and the proteins of interest were released either by thrombin (0.06U/µg protein, 4 °C overnight for CDTa and CDTaN–TcdB1–543) or by elution with 10 mM glutathione (CDTb). Eluted GST–CDTb was directly activated by trypsin (0.2 µg/µg protein, 30 min at room temperature). Trypsin was inactivated by 2 mM 4-(2-Aminoethyl)benzensulfonylfluorid, and the solution was dialyzed against PBS overnight. The 6×His-tagged proteins were purified using Protino Ni-IDA columns (Macherey-Nagel, Düren, Germany) following a standard protocol supplied by the manufacturer. The elution buffer was exchanged via ZEBA desalting columns (Thermofisher, Bonn, Germany), and the proteins were stored in 10 mM Tris-HCl, ph 7.4, 20 mM NaCl at −80 °C. In the following, CDTa always means the mature protein without the leader sequence, and CDTb always stands for trypsin-activated CDTb if not stated otherwise, since it was only used for cell culture experiments to deliver CDTa and CDTaN fusion proteins into target cells.
6
Recombinant Protein Production of CPXV and VACV
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Full length CPXVcalpox derived recombinant A27 (rA27) was produced as described previously [38 (link)]. Extracellular domains of VACVNYCBOH derived D8Δ (aa 2–260), H3Δ (aa 21–270) and L1Δ (aa 1–175) were custom-made by Genexpress (Berlin, Germany). Briefly, the following primers and restriction enzymes (restriction sites underlined) were used for cloning: L1ΔF (NdeI) CGTCGGCATATG GGTGCCGCGGCAAG, L1ΔR (NsiI) CCTGTACATGCAT TTGTTTAGGTGCTATTT, D8ΔF (NdeI) CGTCGGCATATG CCGCAACAACTATCTCCT, D8ΔR (NsiI) CCGACGATGCAT CTCTCTCAAATCGGACAACCATC, H3ΔF (NdeI) CGTCGGCATATG ACATTTCCTAATGTTCAT and H3ΔR (BamHI) CGTCGGGGATC CTTATCCTGGATAACGTTTAG. Expression was induced with 2 mM isopropyl β-D-1-thiogalactopyranoside for 3 h at 37°C, His-tagged proteins were isolated under native (D8Δ) or denaturing (all other proteins) conditions and purified using Protino® Ni-IDA columns (Macherey-Nagel, Dueren, Germany) according to standard procedures. E. coli lysate was produced as previously described [39 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!