Taqman high capacity cdna reverse transcription kit

Manufactured by Thermo Fisher Scientific

Sourced in United States

The TaqMan High-Capacity cDNA Reverse Transcription Kit is a product designed for the reverse transcription of RNA to complementary DNA (cDNA). It provides components and protocols for efficient conversion of RNA to cDNA, which can then be used in various downstream applications such as real-time PCR and gene expression analysis.

Automatically generated - may contain errors

Lab products found in correlation

30 protocols using taqman high capacity cdna reverse transcription kit

Quantitative Real-Time PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from 50–100 mg of sample tissue, i.e., liver and ileum, using the miRNeasy Mini kit (Qiagen, Valencia, CA, USA), in accordance with the manufacture’s protocol. A total of 1 µg of RNA from each sample was reverse transcribed in a 20 µL reaction using the TaqMan High Capacity cDNA Reverse Transcription Kit (Life Technologies, Foster City, CA, USA), following the manufacturer’s instruction. Before cDNA synthesis, the RNA concentration and integrity were measured in the LVis Plate using a microplate reader (BMG LABTECH, Cary, NC, USA) and the Experion RNA StdSens Analysis Kit (Bio-Rad, Hercules, CA, USA). RNA with an integrity score >7.5 integrity was used for cDNA synthesis. cDNA was amplified using Fast Sybr Green Master Mix, according to the manufacturer’s protocol. The 15 µL reaction was conducted on a 7500 Fast Applied Biosystems Real-Time PCR System (Life Technologies, Foster City, CA, USA). Sample cycle threshold (Ct) values for each sample were determined using the Applied Biosystems software. Relative gene expression was determined by calculating the 2^−∆Ct method relative to B₂M gene amplification (B₂M, Genebank NM_213978, 70 bp primers, Qiagen, Valencia, CA USA). Primer sequences used have been previously published [23 (link)].

Babawale E.A., Jones P.J., Mercer K.E., Lin H., Yeruva L., Bar Yoseph F, & Rutherfurd S.M. (2018). Modulating Sterol Concentrations in Infant Formula Influences Cholesterol Absorption and Synthesis in the Neonatal Piglet. Nutrients, 10(12), 1848.

+ Open protocol

+ Expand

Gene Expression Analysis of Mouse Ear Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mice were euthanized at indicated time points after exposure to infected sand flies, non-infected sand flies, or after needle injection. The whole ear was homogenized using MagNA Lyser Green Beads (Roche) and total RNA was extracted using PureLink RNA Mini kits (Ambion). Five hundred nanograms of total RNA was reverse-transcribed into cDNA using random hexamers with the Taqman High-Capacity cDNA Reverse Transcription kit (Life Technologies). Expression of the genes listed in Table S2 was determined using Taqman Gene Expression assays (Applied Biosystems) in the CFX96 Touch Real-Time System (BioRad, Hercules, CA). Expression values were determined by the 2^-ΔΔCt method; samples were normalized to GAPDH expression and determined relative to expression values from naïve mice.

Dey R., Joshi A.B., Oliveira F., Pereira L., Guimarães-Costa A.B., Serafim T.D., de Castro W., Coutinho-Abreu I.V., Bhattacharya P., Townsend S., Aslan H., Perkins A., Karmakar S., Ismail N., Karetnick M., Meneses C., Duncan R., Nakhasi H.L., Valenzuela J.G, & Kamhawi S. (2017). Gut Microbes Egested During Bites of Infected Sand flies Augment Severity of Leishmaniasis Via Inflammasome-Derived IL-1β. Cell host & microbe, 23(1), 134-143.e6.

+ Open protocol

+ Expand

Quantifying mRNA Levels of Mitochondrial Fusion Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Relative mRNA levels of SNPH were determined by qPCR. RNA was extracted with PureLink RNA Mini Kit (Life Technologies) following the in-column DNA digestion protocol. Alternatively, RNA from eight normal human tissues was obtained from BioChain and digested with RNAse-free DNAseI (Thermo Scientific). Two μg of RNA were reversed transcribed using random hexamers for 1 h at 37 °C using the TaqMan High-Capacity cDNA Reverse Transcription Kit (Life Technologies#4368814). One μl of cDNA diluted 1:5 was used as template for qPCR reactions with TaqMan Gene Expression (GEX) assays to detect the various transcripts in a ABI7500 Fast Real Time PCR system. The following GEX assays were obtained from TaqMan (Life Technologies): SNPH (Hs00920132_m1), MFN1 (Hs00966851_m1), MFN2 (Hs00208382_m1). ACTB (Hs99999903_m1) and GAPDH (Hs99999905_m1) assays were used as endogenous control to normalize the levels of mRNA across samples. The relative abundance of mRNA was calculated according to the ΔΔCt method.

Caino M.C., Seo J.H., Aguinaldo A., Wait E., Bryant K.G., Kossenkov A.V., Hayden J.E., Vaira V., Morotti A., Ferrero S., Bosari S., Gabrilovich D.I., Languino L.R., Cohen A.R, & Altieri D.C. (2016). A neuronal network of mitochondrial dynamics regulates metastasis. Nature Communications, 7, 13730.

+ Open protocol

+ Expand

Quantifying Murine Hhip Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Samples were reverse-transcribed into complementary DNA using the TaqMan High-Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific, catalog no. 4374966). Complementary DNA (cDNA) was combined with TaqMan MasterMix (Thermo Fisher Scientific, catalog no. 4369016) to perform mouse Hhip (Mm00469580_m1 Hhip) or ActB (Mm02619580_g1) gene expression assays (Thermo Fisher Scientific) using RT-PCR (QuantStudio 7 Flex, Applied Biosystems, Life Technologies). Hhip expression was normalized to ActB and comparison between groups was made using the method of 2^−ΔΔCt.
Murine Hhip TaqMan probe sequence spanning exons 12 to 13 was GTGTGAGCCAGCGTGCCGTCATGGAGGTGTCTGTGTCAGACCGAACAAGTGCCTCTGTAAAAAGGGCTAT.
Murine ActB TaqMan probe sequence spanning exon 3 was CACACCTTCTACAATGAGCTGCGTGTGGCCCCTGAGGAGCACCCTGTGCTGCTCACCGAGGCCCCCCTGAACCCTAAGGCCAACCGTGAAAAGATGACCCAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTAGC.

Caligiuri S.P., Howe W.M., Wills L., Smith A.C., Lei Y., Bali P., Heyer M.P., Moen J.K., Ables J.L., Elayouby K.S., Williams M., Fillinger C., Oketokoun Z., Lehmann V.E., DiFeliceantonio A.G., Johnson P.M., Beaumont K., Sebra R.P., Ibanez-Tallon I, & Kenny P.J. (2022). Hedgehog-interacting protein acts in the habenula to regulate nicotine intake. Proceedings of the National Academy of Sciences of the United States of America, 119(46), e2209870119.

+ Open protocol

+ Expand

cDNA Synthesis from Isolated RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

The isolated RNA underwent reverse transcription using a high-capacity cDNA synthesis kit (TaqMan^® High-Capacity cDNA Reverse Transcription Kit, Thermo Fisher Scientific, Waltham, MA, USA). The cDNA synthesis protocol entailed incubation at 16 °C for 30 min, 42 °C for 30 min, and then 85 °C for five minutes. The cycler was then set to 4 °C to terminate the reaction. The resultant cDNA was stored at −20 ± 2 °C until further analysis.

Kusmierczyk J., Wiecek M., Wojciak G., Mardyła M., Kreiner G., Szygula Z, & Szymura J. (2024). The Effect of Physical Activity and Repeated Whole-Body Cryotherapy on the Expression of Modulators of the Inflammatory Response in Mononuclear Blood Cells among Young Men. Journal of Clinical Medicine, 13(9), 2724.

+ Open protocol

+ Expand

Quantification of miRNA and mRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA, including miRNAs, was extracted from IVD cells using the RNeasy Micro Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. RNA concentration and quality was measured using a NanoDrop ND1000 UV-VIS spectrophotometer (Isogen Life Science, de Meern, the Netherlands). cDNA was synthesized from total RNA in a 20 μL reaction volume using the TaqMan MicroRNA Reverse Transcription kit (ThermoFisher) for analysis of microRNAs, or the TaqMan High Capacity cDNA Reverse Transcription kit (ThermoFisher) for analysis of mRNAs. Quantification of miR-221 was performed using the TaqMan MicroRNA Assays (ThermoFisher), using U6 snRNA for normalization. For the quantification of COL2A1, ACAN, SOX9, FOXO3 and TRPS1 mRNA, the appropriate TaqMan Assays were purchased (ThermoFisher); Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene was used for normalization of mRNA abundance. Polymerase chain reactions were performed with the TaqMan Universal PCR MasterMix (ThermoFisher) using the CFX96TM PCR detection system (Bio-Rad, Hercules, CA, USA). Relative gene expression was calculated using the comparative 2-ΔΔCt method (expressed as fold change). All reactions were performed in triplicate and the experiments were repeated at least six times.

Penolazzi L., Lambertini E., Bergamin L.S., Roncada T., De Bonis P., Cavallo M, & Piva R. (2018). MicroRNA-221 silencing attenuates the degenerated phenotype of intervertebral disc cells. Aging (Albany NY), 10(8), 2001-2015.

+ Open protocol

+ Expand

Quantifying Liver mRNA and mtDNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from liver samples using the RNeasy MiniKit (Qiagen, Valencia, CA, United States) and reverse transcribed to cDNA using the TaqMan High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Waltham, MA, United States). Thereafter, mRNA expression was analyzed via quantitative real-time polymerase chain reaction (TaqMan Fast Advanced Master Mix, Thermo Fisher Scientific, Waltham, MA, United States) using TaqMan gene-specific primers (Thermo Fisher Scientific, Waltham, MA, United States) on a QuantStudio 7 Flex Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, United States), and normalized to that of the 18S rRNA gene. The mitochondrial DNA (mtDNA) copy number was calculated using a mitochondrial gene, cytochrome b (Cytb), normalized against a nuclear gene, Rpph1 (Supplementary Table 1).

Nahata M., Fujitsuka N., Sekine H., Shimobori C., Ohbuchi K., Iizuka S., Mogami S., Ohnishi S, & Takeda H. (2022). Decline in Liver Mitochondria Metabolic Function Is Restored by Hochuekkito Through Sirtuin 1 in Aged Mice With Malnutrition. Frontiers in Physiology, 13, 848960.

+ Open protocol

+ Expand

Quantitative Analysis of RNA Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs were extracted from U251 and LN229 cells using the TRIzol reagent (Sigma) in accordance with the manufacturer’s instruction, reverse transcribed to cDNAs by using a TaqMan High-Capacity cDNA Reverse Transcription Kit (Thermo) for circZNF609, E-cadherin, Vimentin, and SLC2A1, or TaqMan MicroRNA Reverse Transcription kit (Thermo) for miR-378b. qPCR was performed by using a SYBR Green Reverse Transcription PCR kit (Thermo) in a 7500 Sequence Detection system. The relative expression of genes were calculated by the 2^−ΔΔCt method. The normalization of mRNA and miRNA used GAPDH and U6 as internal control. The primers were listed as follows: GAPDH, sense, 5′-TGTGGGCATCAATGGATTTGG-3′, antisense, 5′-ACACCATGTATTCCGGGTCAAT-3′; U6, sense, 5′-CGGGTGCTCGCTTCGCAGC-3′, antisense, 5′-CCAGTGCAGGGTCCGAGGT-3′; E-cadherin, sense, 5′-CGAGAGCTACACGTTCACGG-3′, antisense, 5′-GGGTGTCGAGGGAAAAATAGG-3′; Vimentin, sense, 5′-GACGCCATCAACACCGAGTT-3′, antisense, 5′-CTTTGTCGTTGGTTAGCTGGT-3′; miR-378b, sense, 5′-GGTCATTGAGTCTTCAAGG-3′, antisense. 5′-GGTCTTTCTGCCTCCA-3′; SLC2A1, sense, 5′-AAGGTGATCGAGGAGTTCTACA-3′, antisense, 5′-ATGCCCCCAACAGAAAAGATG-3′.

Zhao Z., Li G., Han Y., Li Y., Ji Z., Guo R, & Yu X. (2021). Circular RNA ZNF609 enhances proliferation and glycolysis during glioma progression by miR-378b/SLC2A1 axis. Aging (Albany NY), 13(17), 21122-21133.

+ Open protocol

+ Expand

Gene Expression Analysis in Rat Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

Samples were reverse transcribed into complementary DNA with the TaqMan High Capacity cDNA Reverse Transcription kit (ThermoFisher Scientific, Carlsbad, CA, USA). Thereafter, they were processed with either the TaqMan Universal PCR kit with the rat Glp1r or Tcf7l2 gene expression assay (ThermoFisher Scientific, Carlsbad, CA, USA) or custom-made primers compatible with the Sybr Green Kit (ThermoFisher Scientific, Carlsbad, CA, USA). Controls consisted of either β-actin or Gapdh. Samples were quantified by RT–PCR (7900 Real-Time PCR system; ThermoFisher Scientific, Carlsbad, CA). All data were normalized relative to the mean housekeeping messenger RNA expression levels as an internal control. Comparison between groups was made using the method of 2^−ΔΔCt.

Duncan A., Heyer M.P., Ishikawa M., Caligiuri S.P., Liu X.A., Chen Z., di Bonaventura M.V., Elayouby K., Ables J.L., Howe W.M., Bali P., Fillinger C., Williams M., O’Connor R., Wang Z., Lu Q., Kamenecka T.M., Ma’ayan A., O’Neill H.C., Ibanez-Tallon I., Geurts A.M, & Kenny P.J. (2019). Habenular Tcf7l2 links nicotine addiction to diabetes. Nature, 574(7778), 372-377.

+ Open protocol

+ Expand

Quantitative PCR Analysis of RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA was extracted by using an RNeasy Minikit (Qiagen, Valencia, CA, USA) and reverse- transcribed by using the TaqMan High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). Quantitative PCR assays were performed by using TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific) and TaqMan gene-specific primer/probes (Supplementary Table 3; Thermo Fisher Scientific) on a QuantStudio 7 Flex Real-Time PCR System (Thermo Fisher Scientific). Expression of mRNA was normalized to that of the 18S rRNA gene.

Nahata M., Mogami S., Sekine H., Iizuka S., Okubo N., Fujitsuka N, & Takeda H. (2021). Bcl-2-dependent autophagy disruption during aging impairs amino acid utilization that is restored by hochuekkito. NPJ Aging and Mechanisms of Disease, 7, 13.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!