Plant dna preparation kit

C. reflexa plants were grown under long day conditions (16 h day/8 h night) at 22 °C, in a greenhouse. Genomic DNA was extracted from frozen tissue using the Plant DNA Preparation Kit (Jena Biosciences, Germany), and PCR was performed with gene specific primers for the candidate gene (C_ref_ r2_000247) CrGRP): FW: ATGAGTTCAAGGGTCTTTCTTCTCC, REV: AGGCTTCGTCGCATCAATGGC; The PCR products were cloned to the pCR8/GW/TOPO TA-cloning vector (Invitrogen™, Thermo Fisher). Reverse primers without stop codon allowed for C-terminal fusion to a GFP tag after recombining via LR-reaction (LR-clonase® II Plus enzyme mix, Invitrogen™) into respective vectors (pB7FWG2.0, pK7FWG2.0, both with C-terminal GFP tag; plant systems biology, university of Gent). For cloning of a CrGRP cDNA construct, total RNA was extracted from tomato plants (RNeasy Plant Mini Kit, Quiagen), and cDNA was synthesized by reverse transcription (First-Strand cDNA Synthesis Kit, GE Healthcare Life Sciences); PCR was performed with primers above. For subcellular localization, CrGRP has been cloned via LR-reaction into a modified version of pGWB660, including a tagRFP^{28 (link)}.

Plant DNA Preparation Kit (Jena Bioscience, Germany) was employed to extract the genomic DNA with slight modification of the manufacturer’s protocol. Two eukaryotic universal primers to amplihy the specific region of nuclear-encoded small subunit ribosomal RNA gene (18S rDNA), SR1 (forward, 5ʹ-TACCTGGTTGATCCTGCCAG-3ʹ) and SR12 (reverse, 5ʹ-CCTTCCGCAGGTTCACCTAC-3ʹ) were used^{44 (link)}. PCR mastermixes were prepared by using Promega Kit (Promega, USA). The PCR reaction conditions were as described; 30 cycles of initial denaturation at 94 °C for 2 min, denaturation at 98 °C for 10 s, annealing at 53 °C for 30 s, and extension at 72 °C for 2 min. Amplified DNA was sequenced by First Base Laboratory Sdn. Bhd. (Kuala Lumpur, Malaysia), and the sequences were analysed by BLAST algorithm available on National Center for Biotechnology Information (NCBI) website. Genbank database sequecnces having 90–99% similarity With the analyzed sequence were aligned by using MEGA X software. The phylogenetic tree was constructed using Maximum likelihood method with bootstrap test (1000 replicates).