Log In Sign up
The largest database of trusted experimental protocols

Qiaex 2 gel extraction system

Manufactured by Qiagen
Visit Supplier
Sourced in Germany

The QIAEX II gel extraction system is a lab equipment product designed for the purification of DNA fragments from agarose gels. It allows for the efficient extraction and recovery of DNA fragments from gel slices.

Automatically generated - may contain errors

Lab products found in correlation

Streptavidin agarose bead, by Thermo Fisher Scientific (1 mentions) Purelink rna mini kit, by Thermo Fisher Scientific (1 mentions) Primescript rt reagent kit, by Takara Bio (1 mentions) Pmd19 t vector, by Takara Bio (1 mentions) Mastercycler, by Eppendorf (1 mentions)

Close spelling variants of this product

Gel extraction (53 citations) QIAEX II (26 citations) QIAEX II Gel Extraction (2 citations)

4 protocols using qiaex 2 gel extraction system

1

Gel Extraction and Sanger Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols
When indicated, PCR amplicons were extracted from agarose gels for sequencing analysis by using the QIAEX Ⅱ gel extraction system (QIAGEN, cat # 20051), followed by standard Sanger sequencing (The Cornell Institute of Biotechnology or Eton Bioscience Inc). The primer sequences used for Sanger sequencing are summarized in S4 Table.
Kim C., Latif I., Neupane D.P., Lee G.Y., Kwon R.S., Batool A., Ahmed Q., Qamar M.U, & Song J. (2021). The molecular basis of extensively drug-resistant Salmonella Typhi isolates from pediatric septicemia patients. PLoS ONE, 16(9), e0257744.
+ Open protocol
+ Expand
2

PCR Amplicon Sequencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
When indicated, PCR amplicons were extracted from agarose gels for sequencing analysis by using the QIAEX Ⅱ gel extraction system (QIAGEN, cat # 20051), followed by standard Sanger sequencing (The Cornell Institute of Biotechnology or Eton Bioscience Inc). The primer sequences used for Sanger sequencing are summarized in Table 3.
Kim C., Latif I., Neupane D., Lee G.Y., Kwon R.S., Batool A., Ahmed Q., Qamar M.U., & Song J. (2021). The molecular basis of extensively drug-resistant Salmonella Typhi isolates from pediatric septicemia patients.
+ Open protocol
+ Expand
3

Biotinylated Probe Purification and EMSA

Check if the same lab product or an alternative is used in the 5 most similar protocols
A 101-bp DNA fragment containing the κB1 and κB2 sites was amplified by PCR using biotinylated primers and purified using QIAEX II Gel Extraction System (QIAGEN). Purified probes (500 ng) were mixed with nuclear extract (50 μg) in 400 μl of binding buffer [60 mM KCl, 12 mM HEPES (pH 7.9), 4 mM Tris-HCl (pH 8.0), 1 mM EDTA, 1mM EGTA and 12% glycerol] containing 1.66 mM DTT, 0.06% BSA and 20 μg of poly(dI-dC) at 4°C for 2 h. If required, 100 pmol Sp1 binding oligo from CD40 promoter(22 (link)) and 500 pmol indicated competitor oligos were added. Then, pre-cleared streptavidin-agarose beads (life Technologies) were mixed with the DNA–nuclear extract mixture for 2 h. The streptavidin-agarose beads were then washed five times with 1 ml of binding buffer, and then 2x SDS sample buffer was added. The samples were analyzed by Immunoblotting. PCR primers used were as follows: κB forward: biotin-GAAACACC ACAGGTGGGACA; κB reverse, CACACCCATCAGCCGCCCACA; Gitr promoter forward, biotin-TGGGAGAGGCATGTAGGGGTTAGA; Gitr promoter reverse, TTTCCGGCAGACATCTGAGGT
Tone Y., Kidani Y., Ogawa C., Yamamoto K., Tsuda M., Peter C., Waldmann H, & Tone M. (2014). Gene expression in the Gitr locus is regulated by NF-κB and Foxp3 through an enhancer. Journal of immunology (Baltimore, Md. : 1950), 192(8), 3915-3924.
+ Open protocol
+ Expand
4

Cloning and Sequencing of Deer TMSB10

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from cultured RM cells using a PureLink™ RNA mini kit (Life Technologies, USA, 12183018A) according to the manufacturer’s instructions. Reverse transcription (RT) was performed using 1 μg RNA and Primescript RT Reagent Kit (TaKaRa, Dalian, China, R023A). Gene specific primers (Additional file 2: Table S1; TMSB10-RT) were used to amplify the coding region of the full-length cDNA of TMSB10 using an Eppendorf Mastercycler (Germany). Amplification was carried out under the following conditions: 5-min activation step at 95 °C; 35 cycles of 10 s at 95 °C, 5 s at 55.5 °C, and 1 min at 72 °C. The polymerase chain reaction (PCR) products were gel-purified using a QIAEX II gel extraction system (QIAGEN, Germany, 20,021) and cloned into the pMD-19 T vector (TaKaRa, Dalian, China, 6013). At least three independent clones of each amplicon were selected and sequenced by simultaneous bidirectional DNA sequencing (Sangon Biotech Shanghai Co. Ltd.). The coding amino acid sequence was predicted and described using DNAman software (Version 8.0.8.789) and NCBI (www.ncbi.nlm.nih.gov). The structure of deer TMSB10 protein was analyzed using homologous modeling technologies (SWISS-MODEL, www.swissmodel.expasy.org).
Zhang W., Chu W., Liu Q., Coates D., Shang Y, & Li C. (2018). Deer thymosin beta 10 functions as a novel factor for angiogenesis and chondrogenesis during antler growth and regeneration. Stem Cell Research & Therapy, 9, 166.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!