Q5 polymerase reaction buffer

ss-dsDNA strands were created by filling in ssDNA templates (IDT DNA) with primer TCTGCTCTGCACTCGTAATAC (Eton Bioscience) at a ratio of 1:40 using 0.5 µL of Q5 High-Fidelity DNA Polymerase (NEB, M0491S) in a 50 µL reaction containing 1x Q5 polymerase reaction buffer (NEB, B9072S) and 2.5 mM each of dATP (NEB, N0440S), dCTP (NEB, N0441S), dGTP (NEB, N0442S), dTTP (NEB, N0443S). The reaction conditions were 98 °C for 30 s and then 4 cycles of: 98 °C for 10 s, 53 °C (1 °C s⁻¹ temperature drop) for 20 s, 72 °C for 10 s, with a final 72 °C extension step for 2 min. ss-dsDNA strands were purified using AMPure XP beads (Beckman Coulter, A63881) and eluted in 20 μL of water.

First-strand synthesis was generated by mixing 5 µL of RNA with 500 nM of reverse primer in a 20 µL reverse transcription reaction (Bio-Rad, 1708897) containing 4 µL of reaction supermix, 2 µL of GSP enhancer solution, and 1 µL of reverse transcriptase. The mixture was incubated at 42 °C for 30 or 60 min, followed by a deactivation of the reverse transcriptase at 85 °C for 5 min. To generate ample product for gel electrophoresis analyses, the resultant cDNA was diluted 100-fold, and 1 µL was used as the template in a PCR amplification containing 0.5 µL of Q5 High-Fidelity DNA Polymerase (NEB, M0491S), 1x Q5 polymerase reaction buffer (NEB, B9072S), 0.5 uM of forward and reverse primer, 2.5 mM each of dATP (NEB, N0440S), dCTP (NEB, N0441S), dGTP (NEB, N0442S), dTTP (NEB, N0443S) in a 50 µL total reaction volume. The amplification conditions were 98 °C for 30 s and then 25 cycles of: 98 °C for 10 s, 55 °C for 20 s, 72 °C for 10 s with a final 72 °C extension step for 2 min. The products were assayed by gel electrophoresis and their concentrations were measured by Fragment Analyzer HS NGS Fragment Kit (Agilent Technologies Inc., DNF-474-0500).