Log In Sign up
The largest database of trusted experimental protocols

Yap1 wt

Manufactured by Addgene
Visit Supplier

YAP1 wt is a recombinant protein that corresponds to the full-length wild-type version of the human Yes-associated protein 1 (YAP1). YAP1 is a key regulator of the Hippo signaling pathway, which plays a crucial role in controlling organ size, cell proliferation, and cell death.

Automatically generated - may contain errors

Lab products found in correlation

Plenticrisprv2 vector, by Addgene (1 mentions)

Spelling variants of this product

PLL3.7-EF-EYFP-YAP1_WT-PolyA (2 citations)

2 protocols using yap1 wt

1

CRISPR Knockout and Gene Expression Manipulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The DGUOK knockout was performed using pLenti CRISPR V2 vector (Addgene_52961) encoding sgRNA targeting human DGUOK, and the sequences are as follows: sg1: ACTTAGAAAGAGGCGGCCCG; sg2: AGGAGGAAACGCCCTCGAGT; sg3: CCTTCGATGGAGAGCCTTCG; sg4: CGGGCCGCCTCTTTCTAAGT; sg5: CCCCGAAGGCTCTCCATCGA or mouse: sg1: CACGAGCGCGTTCCGCAGCG; sg2: TCGTGGACGCGCCACACGCC; sg3: TCCACGAGCGCGTTCCGCAG; sg4: GGGGCCGCCCCCGTCGTGCA; sg5: ACGCTCGGAGACGACGCAGA. YAP1 wt (Addgene_42555), YAP1 6SA (Addgene_42562), YAP1 sh1 (Addgene_42540), YAP1 sh2 (Addgene_42541), and NDI1 (Addgene_72876) expression plasmids were obtained from Addgene. The retroviral and lentiviral particles were packaged in HEK293 cells using the PEI transfection method and concentrated as previously described (Yang et al, 2012).
Lin S., Huang C., Sun J., Bollt O., Wang X., Martine E., Kang J., Taylor M.D., Fang B., Singh P.K., Koomen J., Hao J, & Yang S. (2019). The mitochondrial deoxyguanosine kinase is required for cancer cell stemness in lung adenocarcinoma. EMBO Molecular Medicine, 11(12), e10849.
+ Open protocol
+ Expand
2

YAP1 Expression and Luciferase Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
The hYAP1-Wt expression vector consists of the full-length YAP1 open reading frame cloned into pcDNA3.1 and was donated by Dr. Ka-Fai from Hong Kong SAR, PR China. YAP1 mutants were obtained from Addgene: YAP1-S94A (#33102), YAP1wt (#19045), WW mutant (#19048) and S369A (#18995). The Nanog-LUC reporter gene was donated by Dr. Yanhong Shi from CA, USA. The YAP1 promoter-LUC construct was bought from GeneCopoeia.
Jiang N., Ke B., Hjort-Jensen K., Iglesias-Gato D., Wang Z., Chang P., Zhao Y., Niu X., Wu T., Peng B., Jiang M., Li X., Shang Z., Wang Q., Chang C., Flores-Morales A, & Niu Y. (2017). YAP1 regulates prostate cancer stem cell-like characteristics to promote castration resistant growth. Oncotarget, 8(70), 115054-115067.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!