Each blastomere in an abnormal embryo was analysed by haplotyping approach [16 (link)]. In brief, Sureplex amplified DNA of the blastomere was purified with the Qiaquick PCR purification system (Qiagen, Manchester, UK). Multiplex fluorescent PCR was performed on three to seven microsatellite markers of the aneuploid chromosome (chromosomes 2, 11, 14, 15, 16, 19 or 20). PCR products were separated using a ABI 3500 Genetic Analyzer (Applied Biosystems, Foster City, USA) and the data were analysed using GeneMapper v4.1 (Applied Biosystems).
Qiaquick pcr purification system
Manufactured by Qiagen
Sourced in Germany, United States
The QIAquick PCR purification system is a laboratory equipment used for the purification of PCR (Polymerase Chain Reaction) amplified DNA fragments. It is designed to efficiently remove primers, nucleotides, polymerases, and other impurities from PCR reactions, providing purified DNA samples suitable for downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Genemapper v4, by Thermo Fisher Scientific (1 mentions)
Abi 3500 genetic analyzer, by Thermo Fisher Scientific (1 mentions)
3130xl genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Big dye buffer, by Thermo Fisher Scientific (1 mentions)
96 well optical plate, by Thermo Fisher Scientific (1 mentions)
Easyselect pichia expression kit, by Thermo Fisher Scientific (1 mentions)
Trifluoracetic acid tfa, by Merck Group (1 mentions)
Ultrapure agarose, by Thermo Fisher Scientific (1 mentions)
Top10 chemically competent e coli, by Thermo Fisher Scientific (1 mentions)
Acetonitrile acn, by Thermo Fisher Scientific (1 mentions)
Zeocin, by Thermo Fisher Scientific (1 mentions)
Trypsin, by Merck Group (1 mentions)
T4 dna ligase, by New England Biolabs (1 mentions)
Pgem t easy vector system, by Promega (1 mentions)
Applied biosystems 3730xl dna analyzer, by Thermo Fisher Scientific (1 mentions)
Gotaq green master mix, by Promega (1 mentions)
Bioruptor twin, by Diagenode (1 mentions)
Dynabeads m 280, by Thermo Fisher Scientific (1 mentions)
Hiseq 2500, by Illumina (1 mentions)
Xbai, by New England Biolabs (1 mentions)
9 protocols using qiaquick pcr purification system
1
Haplotyping for Blastomere Analysis
2
PCR Amplicon Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For sequencing, PCR amplicons were purified using QIAquick PCR purification system (Qiagen, Hilden, Germany) according to the manufacturer’s recommendations (QIAGEN GmbH 2006). In a 96-well plate, 10 μL reactions were then set up, containing 2 μL of the purified amplicon, a sequencing primer at 2 μM, 1x Big Dye buffer (Applied Biosystems), 1 μL of Big Dye Ready Reaction Mix v3.1 (Applied Biosystems), and nuclease-free water. The plate was sealed and pulse centrifuged, after which the PCR was performed under the following conditions: and initial 94 °C for 4 sec, followed by 25 3-step cycles at 94 °C for 30 sec, 50 °C for 15 sec, and 60 °C for 4 min. Sequence reaction products were purified with the Agencourt CleanSEQ sequencing reaction clean-up system (Protocol 000600v031, 2006, Agencourt Bioscience, USA). Purified DNA was resuspended in 40ul of nuclease-free water (Life technologies, Ambion, USA). The products were transferred into a 96-well optical plate (Applied Biosystems, USA) and read using a 3130xl Genetic Analyzer (Applied Biosystems, USA) to generate sequence data.
3
Recombinant Protein Expression in Pichia
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All oligonucleotides were synthesized by Integrated DNA Technologies (Coralville, IA). Accuprime High Fidelity (HF) Taq Polymerase System, the EasySelect Pichia Expression Kit (including the vector pPICZαA), Zeocin, ultra-pure agarose, and TOP10 chemically competent E. coli were purchased from Invitrogen (Carlsbad, CA). All restriction enzymes, T4 DNA Ligase, and additional PCR supplies were purchased from New England Biolabs (Ipswich, MA). GFX gel band purification system was purchased from GE Healthcare (Piscataway, NJ). QIAquick PCR purification system was purchased from Qiagen (Valencia, CA). Sep-Pak Light C-18 cartridges were purchased from Waters Division (Milford, MA). Centriprep ultrafiltration units were purchased from Millipore (Billerica, MA). Trypsin, trifluoracetic acid (TFA), and all salts were purchased from Sigma-Aldrich (St. Louis, MO). Yeast media reagents, Whatman DEAE cellulose, and acetonitrile (ACN) were purchased from Fisher Scientific (Pittsburgh, PA).
4
PCR Product Cloning and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PCR products were cleaned using QIAquick PCR purification system (Qiagen), and cloned into pGEM-Teasy vector system (Promega, USA) and transformed to Escherichia coli JM109 competent cells. From these, 20 clones of each gene were selected, plasmid was purified and further characterized by DNA sequencing. Plasmids were sequenced using the Big Dye Kit (Perkin-Elmer, Worthington, UK) and run on an ABI 377automated sequencer from Perkin-Elmer. DNA and deduced amino acid sequences were analyzed using genetics Computer Group package (Madison, WI, USA). The nucleotide and deduced amino acid sequences were identified using the BLAST search at NCBI.
5
CDH1 and pre-miR-4534 Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA or RNA was amplified by PCR or directional RT–PCR, respectively, with the indicated primers for the CDH1 and paRNA (CDH1 −281F, −139R) and pre-miR-4534 (pre-miR −194F, +99R) (Supplementary Table 2 ). After gel electrophoresis, PCR products were purified using Qiaquick PCR purification system (Qiagen) and sequenced.
6
16S rRNA Sequencing Protocol for Bacterial Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For 16S rRNA sequencing, single colonies were suspended in 100 μl of sterile water and heated to 100°C for 15 min. The suspension was centrifuged for 10 s at 6,400 rpm and 5 μl of each suspension were used as the template for PCR amplification of the 16S rRNA gene. PCR was performed using a mix of 25 μl of GoTaq® Green Master Mix (Promega, Madison, WI, USA), 18 μl of PCR certified water (Promega), and 1 μl each of forward primer (8FPL, AGTTTGATCCTGGCTCAG) and reverse primer (806R, GGACTACCAGGGTATCTAAT) as previously described (Vornhagen et al. 2013 (link)). PCR products were cleaned using the QIAquick PCR Purification System (Qiagen, Valencia, CA, USA) according to the manufacturer's protocol. The purified DNA was checked for quantity and purity using a NanoQuant Tecan M200 (Tecan, Durham, NC, USA). Sequencing was performed by the DNA Sequencing Core at the University of Michigan (Ann Arbor, MI, USA) using Applied Biosystems 3730xl DNA Analyzers (Applied Biosystems, Carlsbad, CA, USA), BigDyev3.1 chemistry (MCLAB, San Francisco, CA, USA), and the protocols recommended by the manufacturer. Resulting partial 16s rRNA gene sequences were analyzed using CHROMAS (Brisbane, Australia) and compared to known sequences in the National Center for Biotechnology (NCBI) database using the Basic Local Alignment Search Tool (BLAST).
7
ENCODE ChIP-Seq Protocol for Cell Lines
8
Cloning and Expression of envZ Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
envZ gene (wild-type or G697A base pair mutant corresponding to D233N amino acid mutant) was amplified from genomic DNA of the corresponding strain using High-Fidelity Phusion DNA polymerase as described above with the primers EnvZ_F_SacI and EnvZ_R_XbaI that possess additional restriction sites for SacI and XbaI enzymes (New England Biolabs, Ipswich, MA). Primer sequences are listed in Table S1. The PCR product and plasmid pSRK (52 (link)) were digested with both enzymes and digested products were gel-purified using QIAquick PCR purification system (Qiagen, Hilden, Germany). Products were then ligated and transformed in TOP10 E. coli . Colonies were screened by PCR using T7_F and T7_R primers and strains with an insert of the expected size were further verified by Sanger sequencing (Microsynth, Balgach, Switzerland) using primers T7_F and T7_R. Plasmids containing the correct insert were isolated from bacteria and stored at −20°C for later use. Plasmids were then transformed into strains of interest by heat shock transformation and plated on selective medium containing 20 μg/mL gentamicin.
9
Sequencing of HIV-2 Reverse Transcriptase and Protease
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nested PCR products were purified using QIAquick PCR purification system (Qiagen, Hilden, Germany) according to the manufacturer's instructions. Cycle sequencing was performed using the Big Dye terminator v3.1 Cycle Sequencing kit (Applied Biosystems). The DNA fragments were sequenced on both strands with sense primers RT3 and RT5-HIV2 and antisense primers RT4 and RT6-HIV2 for the RT region and primers PR3 and PR2 for the PR region (Table 1 ). A 10 μl reaction mixture, consisting of 2 μl each of 5X Big Dye Sequencing Buffer, Big Dye Terminator Mix, 2 μM primer, nuclease-free water and purified PCR product, was taken through 94°C for 2 minutes, 25 cycles of 94°C for 30 seconds, 50°C for 15 seconds, and 60°C for 4 minutes. Cycle-sequenced products were purified using AgenCourt CleanSeq kit (Agencourt Bioscience Corporation; Beverly, MA) according to manufacturer's protocol and loaded onto an ABI 3130xl genetic analyzer (Applied Biosystems) to read out sequences.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!