Qscript xlt one step rt pcr kit

Serum HBV DNA/RNA were copurified with QIAamp MinElute Virus kit (Qiagen, Hilden, Germany) from 200 μL of patient serum. Eluted DNA/RNA mixture was subjected to PCR (Quantabio, Beverly, MA) for DNA analysis by a pair of pan‐genotype primers covering the reverse transcriptase region, RT_s: 5′‐CTGCTGGTGGCTCCAGTT‐3′ ‐ and RT_as: 5′‐GCCTTGTAAGTTGGCGAGAA‐3′‐. HBV RNA was purified following a subsequent digestion with 1 U of DNase I (Thermo Fisher Scientific, Waltham, MA) for 30 minutes at 37°C to eliminate HBV‐DNA contamination. To ensure that no residual HBV DNA existed after DNase I digestion, all the DNase I–treated samples were confirmed to be negative by subsequent PCR analysis to prove that residual serum DNA was eliminated completely (Supporting Fig. S1). The reverse‐transcriptase region of serum HBV RNA was amplified by RT‐PCR using the qScript XLT one‐step RT‐PCR kit (Quantabio). HBV DNA in plasma samples were quantified by the Roche COBAS TaqMan HBV Test. Serum HBV RNA was quantified by one‐step reverse‐transcription RT‐qPCR in a LightCycler 480 Instrument II system (Roche, Mannheim, Germany) with the TaqMan probe method as described.⁽³⁰⁾