Stratagene mx3005p

Manufactured by Agilent Technologies

Sourced in United States, United Kingdom, Germany, China, Japan, Canada

The Stratagene Mx3005P is a real-time PCR (qPCR) system designed for quantitative gene expression analysis. It provides multi-color fluorescence detection capabilities and supports 96-well microplates. The Mx3005P system is capable of performing real-time PCR experiments with various fluorescent dyes and reporter technologies.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Mx3005P (177 citations) Stratagene Mx3005P qPCR System (74 citations) Stratagene Mx3005P system (50 citations) Stratagene Mx3005P instrument (23 citations) Stratagene Mx3005P qPCR machine (8 citations) Stratagene Mx3005P PCR system (7 citations) Stratagene Mx3005P Real-time PCR Detection System (6 citations) Stratagene Mx3005P machine (6 citations) Stratagene MX3005P real-time PCR machine (6 citations) Stratagene™ Mx3005P qPCR instrument (4 citations)

216 protocols using stratagene mx3005p

Cardiac Hypertrophy Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from whole mouse hearts (Qiazol method, Qiagen, Venlo, Limburg, Netherlands) and cDNA was synthesized (High-Capacity RNA-to-cDNA kit, Applied Biosystems, Carlsbad, CA). Samples were run on Stratagene Mx3005P (Agilent Technologies, Santa Clara, CA) using ABsolute™ Blue qPCR Mix, SYBR Green, ROX (Thermo Scientific, Kalamazoo, MI). Primer sequences are listed in Table 1.
NRVM RNA was isolated using a Macherey-Nagel NucleoSpin RNA kit (Takara Bio USA, Inc, Düran, Germany) and cDNA was synthesized using a BioScript All-in-One cDNA Synthesis SuperMix (Biotool, Stratech Scientific Limited, Suffolk, UK). Samples were run on Stratagene Mx3005P (Agilent Technologies, Santa Clara, CA) using SYBR Green qPCR Master Mix (Biotool, Stratech Scientific Limited, Suffolk, UK) to assess levels of GAPDH and ANF. Results were analyzed using the ΔΔCt method (14 (link)). Primers sequences are listed in Table 1. Cells were treated with 10uM phenylephrine (PE±tranilast; 100μM) for 24 hours to induce hypertrophic signaling.

Koch S.E., Nieman M.L., Robbins N., Slone S., Worley M., Green L.C., Chen Y., Barlow A., Tranter M., Wang H., Lorenz J.N, & Rubinstein J. (2018). Tranilast blunts the hypertrophic and fibrotic response to increased afterload independent of cardiomyocyte transient receptor potential vanilloid 2 channels. Journal of cardiovascular pharmacology, 72(1), 40-48.

+ Open protocol

+ Expand

Quantifying Viral DNA from Diverse Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was extracted from tissues issuing the QIAamp Fast DNA Tissue Kit (ref. 51404; QIAGEN). Assays results were reported by Real-time PCR Equipment Mx3005P Stratagene (Agilent Technologies). For tissues, results were adjusted to double-stranded vector copies/microgram genomic DNA. Those tissue samples analyzed with <500 ng genomic DNA/reaction are noted in Results. For plasma, urine, feces, and saliva (shedding samples), results were adjusted to ss vector copies. Results are expressed considering the volume of sample (copies/100 μL plasma or urine, copies/100 mg feces, and copies/saliva swab).

Baruteau J., Cunningham S.C., Yilmaz B.S., Perocheau D.P., Eaglestone S., Burke D., Thrasher A.J., Waddington S.N., Lisowski L., Alexander I.E, & Gissen P. (2021). Safety and efficacy of an engineered hepatotropic AAV gene therapy for ornithine transcarbamylase deficiency in cynomolgus monkeys. Molecular Therapy. Methods & Clinical Development, 23, 135-146.

+ Open protocol

+ Expand

Real-Time PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from each sample was reverse‐transcribed to cDNA using a GoScript™ Reverse Transcription System (Promega). Real‐time PCR was performed using Promega GoTaq^® qPCR Master Mix (Promega) on Mx3005P Stratagene (Agilent). All data were normalized to ARF5 expression and further normalized to the control sample unless otherwise indicated. Primer sets were listed in Table S14.

Lyu X., Zhu X., Zhao M., Zuo X., Huang Z., Liu X., Jiang T., Yang X., Li X., Long X., Wang J., Li J., Han M., Wang S., Liu T., Zhang B., Sun T., Cheng Z., Qiu M., Dong L., Zheng L., Zhang L., Wang J., Wei G., Yao K., Wang Q., Zheng H, & Li X. (2018). A regulatory mutant on TRIM26 conferring the risk of nasopharyngeal carcinoma by inducing low immune response. Cancer Medicine, 7(8), 3848-3861.

+ Open protocol

+ Expand

Real-Time PCR Analysis of GmCYP78A Genes

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs were isolated from plant tissues with Trizol (TIANGEN Biotech, Beijing, China) following the manufacturer’s instructions. RNA quality was determined by a Nanophotomoter (Implen, München, Germany). The removal of genomic DNA residues, reverse transcription and cDNA synthesis were separately performed with 2 μg of total RNA and a FastQuant cDNA RT Kit (TIANGEN Biotech). Real-time PCR analysis of GmCYP78As was performed with the FastStart Essential DNA Green Master (Roche, Shanghai, China) on a Stratagene Mx3005P (Agilent Technologies, Santa Clara, CA, USA, Supplementary Table S1). The relative expression levels were calculated from three replicates using the 2^−ΔΔCt method after normalization to the Actin11 control in soybean [31 (link)].

Dai A.H., Yang S.X., Zhou H.K., Tang K.Q., Li G., Leng J.T., Yu H., Zhang Y.H., Gao J.S., Yang X., Guo Y.J., Jiang N, & Feng X.Z. (2018). Evolution and Expression Divergence of the CYP78A Subfamily Genes in Soybean. Genes, 9(12), 611.

+ Open protocol

+ Expand

Thermal Shift Assay for Ligand Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols

DSF was used to measure the shift in transition temperature upon ligand binding, using a Stratagene MX3005 P (Agilent Technologies, Santa Clara, CA, USA). 25 µl of reactions containing 5 µg of HA wild-type or mutant, 5X SYPRO Orange (Invitrogen), 50 mM Tris-HCl (pH 8), and 100 mM NaCl were incubated at 25 °C for 30 s. Temperature increment at the rate of 0.5 °C every 30 s for 50 min and relative fluorescence units were recorded at the excitation and emission wavelengths of 492 nm and 610 nm, respectively. Transition temperature was calculated from the maxima of the first derivative of relative fluorescence units/temperature using MxPro QPCR Software.

Seok J.H., Kim J., Lee D.B., Cho K.J., Lee J.H., Bae G., Chung M.S, & Kim K.H. (2017). Conformational modulation of influenza virus hemagglutinin: characterization and in vivo efficacy of monomeric form. Scientific Reports, 7, 7540.

+ Open protocol

+ Expand

Reverse Transcription and qPCR for CHO-K1 RNA-seq Validation

Check if the same lab product or an alternative is used in the 5 most similar protocols

To con rm CHO-K1 RNA-seq data, reverse transcription of RNA fi samples was performed using the SuperScript III Reverse Transcriptase kit (Invitrogen), according to the manufacturer s instructions. Speci c ' fi primers for 11 transcripts were designed to target exon-intron boundaries by Primer-BLAST (Supplementary Table S1). A standard curve was performed for each primer set to assess its e ciency, using a 5-fold ffi serial dilutions of pooled cDNA and water as non-template control.
Quantitative real-time PCR was conducted in triplicate using SYBR green based qPCR ampli cation (SYBR green Master Mix, Thermo fi Fisher Scienti c) on the Stratagene MX3005 P (Agilent) equipment with fi the following parameters: 50 °C for 2 min, 95 °C initial denaturation for 10 min, 40 cycles of 95 °C for 15 s and 60 °C for 1 min. Fluorescence was detected at the end of each cycle at 60 °C. GAPDH, a commonly used housekeeping gene, was found to be signi cantly regulated on the RNA-fi seq data. Therefore, Eif3i was chosen as an internal reference. Data analysis was performed using the delt A-D elta Ct method (Livak and Schmittgen, 2001) .

Tossolini I., López-Díaz F.J., Kratje R, & Prieto C.C. (2018). Characterization of cellular states of CHO-K1 suspension cell culture through cell cycle and RNA-sequencing profiling. Journal of biotechnology, 286.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Cln3 and Gapdh

Check if the same lab product or an alternative is used in the 5 most similar protocols

Using nuclease-free water, cDNA samples were diluted 1:20. Quantitative polymerase chain reactions were performed using Absolute Blue Q-PCR Mix (Thermo Fisher Scientific). Cln3 (Forward primer: 5′-TGGAGACCAGTGACAAGCA-3′; Reverse primer: 5′-TCAAGGGAGGTGACAGAGGA-3′) and Gapdh expression (Forward primer: 5′-ACCACAGTCCATGCCATCAC-3′; Reverse primer: 5′-TCCACCACCCTGTTGCTGTA-3′) were quantified. Reactions were performed in a Stratagene Mx3005P (Agilent Technologies) under the following conditions: 1) 95 °C for 15 min. (1 cycle) and 2) 95 °C for 15 s.; 60 °C for 1 min. (40 cycles). 2^-ΔΔCT method was used to analyze relative fold expression^{65 (link)}.

Langin L., Johnson T.B., Kovács A.D., Pearce D.A, & Weimer J.M. (2020). A tailored Cln3Q352X mouse model for testing therapeutic interventions in CLN3 Batten disease. Scientific Reports, 10, 10591.

+ Open protocol

+ Expand

Quantifying Gene Expression in Embryos

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using TRIzol Reagent (Life Technologies) from pool of 30 embryos according to the manufacturer’s directions. cDNA was made using ProtoScript II Reverse Transcriptase and random hexamer primers (New England Biolabs). Quantitative PCR was performed on Stratagene Mx3005P (Agilent Technologies) using Luna Universal qPCR Master Mix (New England Biolabs). Each experiment was performed in triplicate. Primers for p53, mdm2, and p21 are previously described (Ear et al. 2015 (link)), and primers for rps9 are as follows: rps9-oligoF: 5′-AGAAGGATCCTAAGCGTCTC-3′, rps9-oligoR: 5′-CTCTCCAAGAAATCCTCCAC-3′.

Chen C., Huang H., Yan R., Lin S, & Qin W. (2019). Loss of rps9 in Zebrafish Leads to p53-Dependent Anemia. G3: Genes|Genomes|Genetics, 9(12), 4149-4157.

+ Open protocol

+ Expand

FRMD7 Gene Editing in hiPSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

409-B2 hiPSCs were edited in the FRMD7 gene using Cas9 ribonucleoprotein and DNA donor electroporation and cells were treated with or without 2 μM M3814 for 3 days. After recovery for three days cells were sorted using a single-cell printer (Cytena) with hydrophobic cartridges to establish cellular clones. DNA extracts were used for target amplification with PCR from which Illumina libraries were made and sequenced. Amplicon sequence analysis was carried out as described above. To determine FRMD7 copy number, a TaqMan assay was done (ThermoFisher, 4400294, reporter target sequence: FAM-TTGCAGTGGGCTCTACATAGC-NFQ; human RNAse P copy number reference, ThermoFisher, 4403328; TaqMan genotyping master mix, ThermoFisher, 4371355). Quantitative PCR was carried out in a Stratagene MX3005P (Agilent Technologies). Long range PCR (∼3 kb) of the FRMD7 locus was done in a T100 Thermal Cycler (Bio-Rad) using the KAPA2G Robust PCR Kit (SIGMA, KK5024) with buffer B and 3 μl of DNA extract in a total volume of 25 μl. The thermal cycling profile of the PCR was: 95°C 3 min; 30× (95° 15 s, 65°C 15 s, 72°C 60 s); 72°C 60 s. Primers are stated in Supplementary Table S1.

Riesenberg S., Chintalapati M., Macak D., Kanis P., Maricic T, & Pääbo S. (2019). Simultaneous precise editing of multiple genes in human cells. Nucleic Acids Research, 47(19), e116.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from the lumbar intumescence using a commercial kit (RNeasy Lipid Tissue Kit, Qiagen, Cat. code: 74804) and then quantified in a spectrophotometer (Nanophotometer, Implen). cDNA was obtained from 1 μg total RNA also using a commercial kit (Agilent Technologies, Affinity Script QPCR cDNA Synthesis Kit, Cat. code: 600559) and then amplified (1 μL sample) in a thermocycler (Stratagene Mx3005-P, Agilent Technologies) using SYBR Green reagent (Agilent Technologies, Brilliant II SYBR Green QPCR Master Mix, Cat. code: 600828) and the following primers (5 pmol): Pirb (F:GTCTGTGGCCTTCATCCTGTTCC, R:TGTTCAGCTCCACTCCATCCTCAG) [17 (link)], B2m (F:ATGGCTCGCTCGGTGACCCTG, R:CCGGTGGGTGGCGTGAGTATACTT) and Gapdh (F:TGCACCACCAACTGCTTA, R:GGATGCAGGGATGATGTTC). All procedures were performed according to the manufacturer’s instructions. Samples were analyzed in triplicate, and mRNA levels were obtained by the normalization of the target gene to the endogenous reference (Gapdh) and then relativized to the calibrator samples (non-operated) using the formula 2^-ΔΔCt.

Bombeiro A.L., Thomé R., Oliveira Nunes S.L., Monteiro Moreira B., Verinaud L, & de Oliveira A.L. (2016). MHC-I and PirB Upregulation in the Central and Peripheral Nervous System following Sciatic Nerve Injury. PLoS ONE, 11(8), e0161463.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!