Chromatin immunoprecipitation assay kit

Chromatin immunoprecipitation (ChIP) was performed using the Chromatin Immunoprecipitation Assay Kit (EMD Millipore, product#) according to the manufacturer’s instructions. The precipitates were analyzed by PCR using the primers listed in Supplementary Table S2.

The activity of the −1900 to +50 regions of the ALDOA promoter was tested by dual-luciferase assays. Individual groups of cells were co-transfected with the plasmids for one fragment in the region to control luciferase expression, together with the Renilla luciferase reporter for 24 h. The levels of firefly and Renilla luciferase activities were measured using a Dual-Luciferase Reporter Assay System (Promega) [43 (link)].
The binding of POU2F1 to the ALDOA promoter was analyzed by ChIP using a Chromatin Immunoprecipitation Assay Kit (EMD Millipore), according to the manufacturer’s instruction. Briefly, individual groups of cells (1 × 10⁷/tube) were harvested and their genomic DNA was extracted and reacted with anti-POU2F1 or control IgG. After IP, the contained DNA was analyzed by PCR using the primers. The sequences of primers were 5′-TAGCACTTTGGGAGGCCAAG-3′ (sense) and 5′-TGGGTTCAAGCGATTCTCCC-3′ (anti-sense) for site 1#; 5′-CCTGGGAGATGAGCGAAAATC-3′ (sense) and 5’-CGAACTCCTGACCTCAAGTGAT-3’ (anti-sense) for Site 2#; 5′-TGCGAAACCCTGTCTCTACT-3′ (sense) and 5′-GCCTCCCGTGTTCAAGTGA-3′ (anti-sense) for Site 3#; 5′-AATCTCAGCTACTCGGGAGG-3′ (sense) and 5′-TTCGCTCATCTCCCAGGC-3′ (anti-sense) for Site 4#; and 5′-CGCCTGTAATCCCAGCTACT-3′ (sense) and 5′-AGTCTCGCTCTGTCGCCC-3′ (anti-sense) for Site 5#. The PCR products were resolved on 2% agarose gels [43 (link)].

Chromatin Immunoprecipitation Assay Kit (EMD Millipore) was used for ChIP assay. The primers for HIF‐1α regulation of FOXO4 were as follows. Site 1#: 5′‐ AATCAGAGGAAGATTTAACC ‐3′ (Forward) and 5′‐ CAGTGGTGTGATCTTGGCTC ‐3′ (Reverse). Site 2#:5′‐ TGTCACCCAGGCTGGAGCAC ‐3′ (Forward) and 5′‐ CAAGACCTATTTATAACTGC ‐3′ (Reverse). Site 3#: 5′‐ TGAGGAGGAACACCACCGTG ‐3′ (Forward) and 5′‐ GAGTCGTGTAGGTGACCAGA ‐3′ (Reverse). The primers for FOXO4 regulation LDHA were as follows. Site 1#: 5′‐ AGGTCTGAAGTCTGAATCCCAG ‐3′ (Forward) and 5′‐ CGCGGTTTATTAACCCCAA ‐3′ (Reverse). Site 2#:5′‐ CCCCCTGCCAGGCTAGAAAC ‐3′ (Forward) and 5′‐ AATGAATGCCCCGAAGCAGA ‐3′ (Reverse). Site 3#: 5′‐ CCGGGGCGGGTTCTTGAAA ‐3′ (Forward) and 5′‐ AAGGGAGTTCCTGCGGACAC ‐3′ (Reverse). Site 4#: 5′‐ CGCGCCCAGCTCAGAGTGC ‐3′ (Forward) and 5′‐ ACAAGCTGAGGCTTTTTTGGC ‐3′ (Reverse).

Cells were washed with cold PBS(−), and kept on ice for 5 min in a cold CSK buffer (10 mm PIPES‐NaOH, pH 6.8, 100 mm NaCl, 3 mm MgCl_2, 1 mm EGTA, 300 mm sucrose, 0.1% Triton X‐100, 1 mm Na₃VO₄, 1 mm NaF, 5 mm glycerol 2‐phosphate). After centrifugation at 2300 g for 5 min, pellet fractions were incubated at 25 °C for 10 min in CSK buffer containing 0.5% formaldehyde, and then incubated with 25 °C for 5 min in 0.125 m glycine/PBS. Immunoprecipitation assays were carried out according to the manufacturer's protocol (Chromatin Immunoprecipitation Assay Kit; Merck Millipore). The quantitative PCR (qPCR) was performed with primers 5′‐GGTCCACGGGCCGCCCTGCCAG‐3′ and 5′‐CGCAGCTCCGGAAGCCGAGAGC‐3′ corresponding to a part of rRNA gene between nucleotide positions −961 and −851, where +1 is set to be the transcription start site 14 using FastStart SYBR Green Master (Roche Molecular Systems, Inc., Hacienda, CA, USA) and Thermal Cycler Dice Real Time System (TaKaRa Bio Inc., Shiga, Japan) according to the manufacturers’ protocols.