Small interfering RNAs (siRNAs) for SNHG5 and ZEB1 and control siRNA were provided by RiboBio. The siRNA sequences were as below: si‐SNHG5, 5′‐AGUAAUAACAAAAAGGAACAU‐3′; si‐ZEB1, 5′‐GGATAAAGAGATGGAAGAA‐3′. miR‐205‐5p mimic, NC mimic, miR‐205‐5p inhibitor and NC inhibitor were also provided by RiboBio. A SNHG5 overexpression vector (pcDNA3.1/SNHG5) and empty vector (pcDNA3.1/Control) were obtained from GeneChem Co.. Vectors containing short hairpin RNAs targeting SNHG5 (sh‐SNHG5) and negative control vector (sh‐NC) were also provided by GeneChem Co.. The sequences of sh‐SNHG5 and SNHG5 overexpressing vectors are listed in Table S1 . Lipofectamine 2000 (Invitrogen) was used to transfect the above RNA oligoribonucleotides or constructs into ccRCC cells following the manufacturer's recommendation.
Mir 205 5p mimic
Manufactured by RiboBio
The MiR‐205‐5p mimic is a synthetic oligonucleotide designed to mimic the function of the naturally occurring microRNA miR‐205‐5p. MicroRNAs are small, non‐coding RNA molecules that play a role in regulating gene expression.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Si snhg5, by RiboBio (1 mentions)
Si zeb1, by RiboBio (1 mentions)
Pcdna3.1 control, by Genechem (1 mentions)
Control sirna, by RiboBio (1 mentions)
Sh nc, by Genechem (1 mentions)
Nc sirna, by RiboBio (1 mentions)
Mimic nc, by RiboBio (1 mentions)
2 protocols using mir 205 5p mimic
1
Targeting SNHG5 and ZEB1 in ccRCC
2
Evaluating miR-205-5p and PTEN in Lung Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
miR-205-5p mimic (50 nM, 5′-UCCUUCAUUCCACCGGAGUCUG-3′), miRNA mimic negative control (mimic NC; 50 nM, 5′-UUCUCCGAACGUGUCACGUTT-3′), miR-205-5p inhibitor (50 nM, 5′-CAGACUCCGGUGGAAUGAAGGA-3′), miRNA inhibitor NC (inhibitor NC) (50 nM, 5′-CAGUACUUUUGUGUAGUACAA-3′), small interfering (si)-PTEN (50 nM, 5′-GACGGGAAGACAAGUUCAUTT-3′) and siRNA NC (si-NC; 50 nM, 5′-GCACAGTTAACCGCATAAA-3′) were all purchased from Guangzhou RiboBio Co., Ltd. Cell transfections were performed using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.), 0.5×106 cells (NCI-H1975 or A549) were inoculated into 6-well plates and incubated at room temperature for 5 min. Following transfection, the cells were used for subsequent experiments 24 h later.
Lung cancer cells (NCI-H1975 or A549) in the logarithmic growth phase were treated with different concentrations of ICA (The concentration range was 5–40 µM and the concentrations of the four treatment groups were 5, 10, 20 and 40 µM, respectively) or control for 24 h at 37°C (14 (link)). ICA was obtained from Shanghai Tauto Biotech Co., Ltd.
Lung cancer cells (NCI-H1975 or A549) in the logarithmic growth phase were treated with different concentrations of ICA (The concentration range was 5–40 µM and the concentrations of the four treatment groups were 5, 10, 20 and 40 µM, respectively) or control for 24 h at 37°C (14 (link)). ICA was obtained from Shanghai Tauto Biotech Co., Ltd.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!