Individual reactions were made up in 0.2 ml PCR tubes (Peqlab 820264-A). RET1 enzyme (see SI text) was added (0.05 μl, 0.2 mg ml−1), UTP (Thermo Scientific R0471 100 mM) was added to a final concentration of 50 μM. RNA substrate (see SI text) was added to a final concentration of 200 nM. Inhibitors were added as required (0.5 μl in DMSO) to a final concentration of 50 μM. When no inhibitor was included 5 % (vol/vol) DMSO was added as control. The volume was made up to 10 μl in buffer D (Tris pH 7.5 10 mM, KCl 200 mM, DTT 1 mM, EDTA 0.5 mM MgCl2 3.2 mM) and the reaction was incubated for 20 mins at 27°C, then inactivated at 65°C for 10 mins. RNA loading dye (10 μl, NEB B363A) was added and tubes were heated (5 mins at 70°C), 10 μl was loaded onto 15 % TBE urea pre-cast gel (Invitrogen EC68852) and run in 1 x TBE buffer for 1.5 h at 130 V. Gels were incubated with Sybr Gold nucleic acid stain (Life Technologies S11494) for 20 mins, then imaged on an ultraviolet trans-illuminator (BioDoc-It imaging system, UVP). Experiments were carried out in duplicate for each inhibitor.
Biodoc it imaging system
Manufactured by Analytik Jena
Sourced in United States, United Kingdom
The BioDoc-It Imaging System is a versatile lab equipment designed for capturing high-quality images of gels, blots, and other samples. The system features a built-in camera and illumination system, allowing for efficient documentation of experimental results.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop, by Thermo Fisher Scientific (6 mentions)
Accupower pcr premix, by Bioneer (2 mentions)
Onetaq quick load 2 master mix, by New England Biolabs (2 mentions)
Gene reagent pack, by Qiagen (2 mentions)
Science x tractor platform, by Qiagen (2 mentions)
Bio dot sf microfiltration apparatus, by Bio-Rad (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Multiskan go, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Sybr gold nucleic acid stain, by Thermo Fisher Scientific (1 mentions)
Mini sub cell gt system, by Bio-Rad (1 mentions)
Mycycler, by Bio-Rad (1 mentions)
Amplitaq gold dna polymerase, by Thermo Fisher Scientific (1 mentions)
Nanodrop one spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Gelred, by Biotium (1 mentions)
Goscript, by Promega (1 mentions)
T gradient thermal cycler, by Analytik Jena (1 mentions)
Maxime rt premix oligo dt15 primer, by iNtRON Biotechnology (1 mentions)
Chemiluminescent substrate kit, by Bio-Rad (1 mentions)
43 protocols using biodoc it imaging system
1
In Vitro Assay of RET1 Enzyme Activity
2
Glycoconjugate Labeling and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 8
Cells were seeded at 3×106/8 ml per 10-cm dish and treated with control and test sugars (200 micromolar Fuc 3 vs. alkynyl derivatized Fuc 1, or 25 micromolar ManNAc 5 vs. alkynyl derivatized ManNAc 2) in growth medium at 37° C. After 3 days, cell extracts were prepared by resuspending the cells in 1 ml of lysis buffer (1% Nonidet P-40/150 mM NaCl/protease inhibitor/100 mM sodium phosphate, pH 7.5). Protein extract (1 mg/ml) was labeled for 1 h at room temperature (conditions as outlined in microscopic analysis; the azido rhodamine probe was a gift from Benjamin F. Cravatt, The Scripps Research Institute). Labeled protein lysate was resolved by SDS/PAGE. For immunoblotting of biotin-labeled glycoconjugates, electrophoresed proteins were transferred onto PVDF membranes, blocked for 20 min with SuperBlock Blocking Buffer, probed for 1 h with anti-biotin MAb (1 microgram/ml), and incubated with peroxidase-conjugated goat anti-mouse IgG (1:7, 500 dilution) for 30 min. Each step was followed by a wash with 0.02% Tween 20/PBS (PBST). Signal was developed with SuperSignal Chemiluminescent Substrate and detected by exposure to x-ray film. For detecting the coumarin-labeled glycoconjugates, gels were examined under 365 nm UV light with a 535+/−50 nm filter. Images were taken by using a BioDoc—It imaging system (UVP). Rhodamine gels were analyzed.
3
Measuring Plasmid Transformation Efficiency
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Three transformations were carried out as shown in Fig. 2A : the intact target plasmid into cells without the chromosomal gene for CisA, the target plasmid without initiation and termination sequences into cells with the chromosomal gene for CisA, and the intact target plasmid into cells with the chromosomal gene for CisA. Transformant colonies were selected on LB agar plates supplemented with chloramphenicol (15 ng/μl) and inoculated to liquid LB cultures with chloramphenicol. After overnight growth in 37°C shaken at 225 rounds per minute (the same growth conditions from here on unless specified otherwise), 1 ml of culture was purified and eluted to 40 μl of elution buffer, and 5 μl was used for electrophoresis (0.8% agarose gel, 110 V, 40 min; Bio-Rad Mini-Sub Cell GT Systems). An image was taken using UVP BioDoc-It Imaging System and analyzed using ImageJ to calculate fraction of the nicked target plasmid with the following equation: brightness of the band for nicked DNA (brightness of the band for nicked DNA + brightness of the band for supercoiled DNA + brightness of the band for linear DNA).
4
Evaluate Bacterial Motility and Inhibition
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cultured S. Typhimurium was suspended in Tris-Maleate buffer (50 mM, pH 6.4) at 1e7 CFU/ml. The semi-solid agar plates were composed of Tris-Maleate buffer (50 mM, pH 6.4), 0.2% w/v casamino acids (BD bacto-tryptone 211705), and 0.3% w/v agar (BD bacto-agar 244520), and prepared the day prior to the experiment. To the center each plate, an aliquot (20μl) was added of either HD6, mouse IgG1 antibody, or Tris-Maleate buffer (50 mM, pH 6.4, as vehicle control). Next, the center of each plate was inoculated with an aliquot (3 μl) of the S. Typhimurium suspension. Plates were then incubated at 37°C for 6.5 hours. After incubation, the plates were photographed using a gel imager (UVP, Upland, CA, BioDoc-It Imaging system). The bacterial motility/swimming parameters were assessed for each plate using ImageJ. Thus, for each image, a circular mask of swimming bacteria was generated using the “Threshold” and “Find Edges” tools. From this mask, the diameter of the circle of swimming bacteria was then measured.
5
RAPD Analysis of In Vitro Regenerated Plants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Twelve in vitro regenerated plants were PCR analysed using RAPD primers to check the extent of genetic similarity. Genomic DNA was isolated from leaves using the cetyltrimethylammonium bromide (CTAB) method [20 (link)]. The DNA concentration was estimated using Multiskan GO (Thermo Scientific). DNA samples were diluted, and the concentration was adjusted up to 50 ng µl−1. A 25 µl reaction mix was prepared for each DNA sample using 10 × PCR buffer, MgCl2 (25 mM), dNTPs (10 mM), primers (10 mM), Taq polymerase (BR Biochem) (0.25 unit/rxn.), autoclaved ddH2O and DNA (1 µl of 50 ng µl−1) as a template. PCR tubes were arranged in My Cycler (Bio-Rad). Reaction conditions were set as denaturation at 94 °C for 5 min (for the 1st cycle), [94 °C for 1 min, annealing at 37 °C for 1 min, extension at 72 °C for 3 min] for 30 cycles, final extension at 72 °C for 10 min and hold at 4 °C for infinite. Gel electrophoresis was performed for the PCR products, and gel pictures were captured using a BioDoc-It™ Imaging System (UVP). Total bands were scored by counting manually.
6
Sperm Genomic DNA Isolation Protocol
7
EMSA for MSMEG_0307 DNA Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA fragments (∼300bp) containing the binding sequence motifs were amplified using PCR and primers (Table S1 ) and further purified. The reactions had a final volume of 10 μl and contained 100 ng of DNA, 1× EMSA buffer (20 mM Tris.HCl pH8, 75 mM NaCl, 10 mM MgCl2) and increasing concentrations of recombinant His-tagged MSMEG_0307 protein (0.01 μg to 1 μg). The reactions were incubated at room temperature for 30 min and then were loaded onto a 5% (v/v) native polyacrylamide gel. Following electrophoresis the gels were stained with ethidium bromide and the bands were visualised using BioDoc-It™ imaging system (UVP, Cambridge, UK).
8
Stability Evaluation of miRNA-exosomes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To investigate the stability of engineered-miRNA-exosomes, the DSPE-PEG-CMP-miR302-EXO and miR302 mimic were incubated in DMEM containing 10% FBS at designated time points (0, 2, 4, 8, 12, 24, 36, 48 and 72 h) at 37 °C. After incubation, the samples were mixed with 1% SDS loading buffer and loaded into a 2% agarose gel in 0.5X TBE. Afterwards, we performed electrophoresis at 90 V for 35 min. The bands were imaged with a BioDoc-It imaging system (UVP, USA).
9
Fetal Sexing by PCR in Livers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sexing of fetuses was carried out by PCR in fetal livers samples. A piece of liver from the right lobe was recovered and snap-frozen in liquid nitrogen. Afterwards, it was stored at −80 °C until analysis.
For PCR, DNA was extracted with DNAzol® Reagent (Invitrogen-Thermo Fisher Scientific, Waltham, MA, USA) following the instructions of the manufacturer. Then, DNA was quantified using the NanoDrop ONE spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Primers OcSRY (F: AGCGGCCAGGAACGGGTCAAG and R: CCTTCCGGCGAGGTCTGTACTTG) and OcGAPDH (F: TGAACGGATTTGGCCGCATTG and R: ATGCCGAAGTGGTCGTG-GATG) were used for amplification according to Vašíček et al. [36 ], with the following PCR conditions: 94 °C 2 min, 94 °C 20 s, 64 °C 30 s, 72 °C 30 s, 72 °C 10 min in 35 cycles [37 ]. The reaction mixture contained a total of 200 ng DNA, 2 mM MgCl2, 0.4 µM of each primer, 200 µM dNTP, and 0.625 U AmpliTaq Gold DNA Polymerase (Applied Biosystems, Waltham, MA, USA). PCR products (4 µL) were checked on 2% agarose gel stained with GelRed™ (Biotium, San Francisco, CA, USA) and low DNA Mass Ladder (Invitrogen Thermo Fisher Scientific, Waltham, MA, USA) was used for verifying the expected size of the product. They were visualized by BioDoc-It Imaging system (UVP, Upland, CA, USA).
For PCR, DNA was extracted with DNAzol® Reagent (Invitrogen-Thermo Fisher Scientific, Waltham, MA, USA) following the instructions of the manufacturer. Then, DNA was quantified using the NanoDrop ONE spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Primers OcSRY (F: AGCGGCCAGGAACGGGTCAAG and R: CCTTCCGGCGAGGTCTGTACTTG) and OcGAPDH (F: TGAACGGATTTGGCCGCATTG and R: ATGCCGAAGTGGTCGTG-GATG) were used for amplification according to Vašíček et al. [36 ], with the following PCR conditions: 94 °C 2 min, 94 °C 20 s, 64 °C 30 s, 72 °C 30 s, 72 °C 10 min in 35 cycles [37 ]. The reaction mixture contained a total of 200 ng DNA, 2 mM MgCl2, 0.4 µM of each primer, 200 µM dNTP, and 0.625 U AmpliTaq Gold DNA Polymerase (Applied Biosystems, Waltham, MA, USA). PCR products (4 µL) were checked on 2% agarose gel stained with GelRed™ (Biotium, San Francisco, CA, USA) and low DNA Mass Ladder (Invitrogen Thermo Fisher Scientific, Waltham, MA, USA) was used for verifying the expected size of the product. They were visualized by BioDoc-It Imaging system (UVP, Upland, CA, USA).
10
RT-PCR for Melanoma Marker Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-PCR was performed with 4.5 μl of RNA samples. The RNA was reverse transcribed using a reverse transcription kit (GoScript, Promega) and amplified using a polymerase chain reaction kit (GoTaq, Promega) according to the manufacture’s protocol. The primer sequence used in PCR were: Melan A forward 5’-CGCTCCTATGTCACTGCTGA- 3’, reverse 5’-GGTGATCAGGGCTCTCACAT-3’; GAPDH forward 5’-AACACAGTCCATGCCATCAC- 3’ reverse 5’-TCCACCACCCTGTTGCTGTA- 3’. The PCR protocol consisted of denaturation (90°C for 5 min), 40 cycles of amplification (90, 50 and 72°C) for 30 s each and extension (72°C for 10 min). The amplified samples were separated by electrophoresis on 1% agarose gel with SYBR Green DNA staining agent (Invitrogen). The band was imaged using a BioDoc-It imaging system (UVP).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!