Jetoptimus transfection reagent

Manufactured by Polyplus Transfection

Sourced in France

JetOPTIMUS is a transfection reagent developed by Polyplus Transfection. It is designed to facilitate the delivery of nucleic acids, such as plasmids, siRNA, and mRNA, into a variety of cell types for various research applications.

Automatically generated - may contain errors

Lab products found in correlation

Opti mem, by Thermo Fisher Scientific (2 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions) Lsm 780, by Zeiss (2 mentions) Luciferase, by Promega (1 mentions) Mcherry n1, by Takara Bio (1 mentions) Sanger sequencing, by Eurofins (1 mentions) Puromycin, by Thermo Fisher Scientific (1 mentions) Sch002, by Merck Group (1 mentions) Pvsv g, by Addgene (1 mentions) Pmdlg prre, by Addgene (1 mentions) Fetal bovine serum (fbs), by Corning (1 mentions) Jetprime transfection reagent, by Polyplus Transfection (1 mentions) Prsv rev, by Addgene (1 mentions) Dual glo luciferase assay, by Promega (1 mentions) Myc tag, by Cell Signaling Technology (1 mentions) Hiscribe t7 quick high yield rna synthesis kit, by New England Biolabs (1 mentions) Dynabeads protein g, by Thermo Fisher Scientific (1 mentions) Complete protease inhibitor cocktail, by Merck Group (1 mentions) Eclipse ti fluorescent microscope, by Nikon (1 mentions) Cetuximab, by MedChemExpress (1 mentions)

22 protocols using jetoptimus transfection reagent

Gibson Assembly of Reporter Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Gibson assembly was used to generate mCherry and Luciferase reporter genes with different 3′UTR variants. Therefore, the backbones of the mCherry-N1 (Clontech) and Luciferase (Promega) plasmids were linearized and inserts were amplified by PCR using specific primers (Additional file 1: Table S9). Backbones and purified PCR inserts were mixed in a 1:3 ratio and ligated using a Gibson Assembly Mastermix (1.3x Isothermal Mastermix [100 mM Tris-HCl pH 7.5, 10 mM MgCl₂, 200 nM dNTPs, 10 mM DTT, 1 mM NAD, 5% (w/v) PEG-8000], 0.1 U T5 exonuclease, 0.5 U Phusion DNA Polymerase, 0.1 U Taq DNA Ligase) at 50 °C for 15 min.
All ligation products were transformed into E. coli TOP10 cells and positive colonies were identified by Sanger sequencing (Eurofins). For the reporter gene assays 5 μg of each plasmid were transfected per 10 cm cell culture dish for 24 h using JetOPTIMUS Transfection Reagent (Polyplus) according to the manufacturer’s instructions. For CPSF6-myc (SinoBiological) and chimera expression experiments 1.5 μg of each plasmid were transfected per 6 cm cell culture dish for 24 h using Lipofectamine 2000 (ThermoFisher Scientific). Cells were starved with Opti-MEM® (ThermoFisher Scientific) for 4 h prior to transfection.

Schwich O.D., Blümel N., Keller M., Wegener M., Setty S.T., Brunstein M.E., Poser I., Mozos I.R., Suess B., Münch C., McNicoll F., Zarnack K, & Müller-McNicoll M. (2021). SRSF3 and SRSF7 modulate 3′UTR length through suppression or activation of proximal polyadenylation sites and regulation of CFIm levels. Genome Biology, 22, 82.

+ Open protocol

+ Expand

Plasmid-Mediated Autophagy Regulation in Prostate Cancer

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Viral packaging plasmids (pRSV-REV, pVSV-G, pMDL-g/p-RRE) were obtained from AddGene. ATG5 short hairpin RNA (shRNA) constructs (TRCN0000151963, TRCN0000151474, TRCN0000330392), ATG7 shRNA constructs (TRCN0000007586, TRCN0000007588, TRCN0000364479), Sigma1 shRNA constructs (TRCN0000296908, TRCN0000291305, TRCN0000061010, TRCN0000061008), and a nontargeting control shRNA construct (SCH002) were obtained from Sigma-Aldrich. The FLAG-AR and FLAG-ARV7 plasmid constructs were gifts from Dr. Stephen Plymate (University of Washington School of Medicine, Seattle, WA) and have been described elsewhere (58 (link)). pEGFP-LC3 was a gift from Drs. Grazia Ambrosini and Gary K. Schwartz [Memorial Sloan Kettering Cancer Center (MSKCC), New York, NY] and has been described previously (56 (link)). Transient transfections were performed with jetPRIME transfection reagent (PolyPlus) according to manufacturer's procedures. LNCaP GFP-LC3 stable cell lines were generated using the pBABE-Puro-mCherry-EGFP-LC3B plasmid construct (Addgene 22418). Transfection was performed with jetOPTIMUS transfection reagent (PolyPlus) according to manufacturer's protocol. Cells were maintained in high-glucose RPMI (Corning) supplemented with 10% FBS (Corning) and 1 µg/mL puromycin (Thermo Fisher Scientific).

Oyer H.M., Steck A.R., Longen C.G., Venkat S., Bayrak K., Munger E.B., Fu D., Castagnino P.A., Sanders C.M., Tancler N.A., Mai M.T., Myers J.P., Schiewer M.J., Chen N., Mostaghel E.A, & Kim F.J. (2023). Sigma1 Regulates Lipid Droplet–Mediated Redox Homeostasis Required for Prostate Cancer Proliferation. Cancer Research Communications, 3(10), 2195-2210.

+ Open protocol

+ Expand

Pseudovirus Generation for SARS-CoV-2 Spike Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols

The plasmid sets used for packaging of pseudoviruses included the reporter plasmid pNL4–3.Luci.R-.E- expressing the firefly gene (3418, AIDS Reagent Program, National Institute of Health), pcDNA3.1-SARS-CoV-2-S expressing the codon-optimized spike gene from Wuhan-Hu-1 strain SARS-CoV-2, kindly provided by Dr. Wei Cun^{30 (link)}, and pcDNA3.1-SARS-CoV-S expressing the spike gene from BJ302 strain SARS-CoV. pcDNA3.1(+) was used to generate a control “naked pseudovirus”. A pseudovirus generated with pMD2.G expressing vesicular stomatitis virus (VSV) G envelope protein (VSV-G) was used as an additional control. To generate a pseudovirus, HEK293T cells were co-transfected with pNL4–3.Luci.R.-E- and pcDNA3.1-SARS-CoV-2-S, pcDNA3.1-SARS-CoV-S, pMD2.G or pcDNA3.1(+) using jetOPTIMUS transfection reagent (117–15, Polyplus). The supernatant was harvested at 48 h post-transfection, centrifuged at 3,000 rpm for 10 min, aliquoted and stored at −80°C for later use.

Zhang F., Li W., Feng J., Ramos da Silva S., Ju E., Zhang H., Chang Y., Moore P.S., Guo H, & Gao S. (2021). SARS‐CoV‐2 pseudovirus infectivity and expression of viral entry‐related factors ACE2, TMPRSS2, Kim‐1, and NRP‐1 in human cells from the respiratory, urinary, digestive, reproductive, and immune systems. Journal of Medical Virology, 93(12), 6671-6685.

+ Open protocol

+ Expand

Genetic Engineering of AZIN1 and OAZ2 in Colorectal Cancer Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The mutant AZIN1 (S367G) open reading frame corresponding to the RNA editing site in AZIN1 was generated using site-directed mutagenesis and confirmed by Sanger sequencing, as previously described [3 (link)]. Viruses were produced by transfection of HEK293 cells with the pHAGE-puromycin control vectors, pHAGE-V5-puromycin expression vectors (carrying AZIN1-WT or AZIN1_S367G), pLVX-shRNA1 negative scramble control vectors, pLVX-IL-8 shRNA#1 (carrying sequence: CCGGCAAGGAGTGCTAAAGAACTTACTCGAGTAAGTTCTTTAGCACTCCTTGTTTTTG) or pLVX-IL-8 shRNA#2 (carrying sequence: CCGGCCGAACTTTAATTTCAGGAATCTCGAGATTCCTGAAATTAAAGTTCGGTTTTTG), and the lentiviral packaging plasmids psPAX2 and pMD2G. HCT 116 and HT-29 cells were transduced by the virus followed by selection with puromycin (HCT 116, 1 μg/mL; HT-29, 2 μg/mL), and after 7 days of antibiotic selection, expression of the constructs was verified by RT-qPCR, western blots and RNA editing fingerprint assay.
Cells were transfected with pCMV6-Entry control vector and pCMV6 expression vector carrying OAZ2 (NM_002537) human tagged ORF, using jetOPTIMUS^® transfection reagent (101000006 from Polyplus), and expression of the constructs was verified by Western blots.

Wei Y., Zhang H., Feng Q., Wang S., Shao Y., Wu J., Jin G., Lin W., Peng X, & Xu X. (2022). A novel mechanism for A-to-I RNA-edited AZIN1 in promoting tumor angiogenesis in colorectal cancer. Cell Death & Disease, 13(4), 294.

+ Open protocol

+ Expand

NiV Mini-Replicon Assay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

The subconfluent monolayer of HEK293T cells was transfected with 100 ng plasmid pPol I NiV-REN, 125 ng phCMV NiV N, 25 ng phCMV NiV P, and 350 ng phCMV NiV L using jetOPTIMUS transfection reagent (Polyplus, Illkirch-Graffenstaden, France). Additional transfection of pGL4.50 (Promega, Madison, WI, USA) encoding the firefly luciferase was performed for normalization of transfection efficiency. In all experiments, the total amount of transfected DNA was kept constant by including additional empty vector plasmid DNA where appropriate. Reporter activity was measured 24 h post-transfection using the Dual-Glo luciferase assay (Promega) following the instructions of the manufacturer. Details about the NiV mini-replicon assay will be published elsewhere.

Roy A., Chan Mine E., Gaifas L., Leyrat C., Volchkova V.A., Baudin F., Martinez-Gil L., Volchkov V.E., Karlin D.G., Bourhis J.M, & Jamin M. (2023). Orthoparamyxovirinae C Proteins Have a Common Origin and a Common Structural Organization. Biomolecules, 13(3), 455.

+ Open protocol

+ Expand

Rac1 Activation Assay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mutations were introduced into the coding region of human RAC1 using Quikchange Lightning (Aligent) according to the manufacturer’s instructions and subcloned in pRK5-myc using BamH1 and EcoR1. RAC1-GTP pulldown assays were performed as previously described.^{7 (link)} Briefly, HEK293 cells were transfected using Jet-OPTIMUS transfection reagent (Polyplus). Transfected cells were then incubated for 24 h before being lysed and active RAC1 isolated using the recombinant Cdc42- and RAC-interactive binding (CRIB) domain of p21 activated kinase (PAK) fused to GST. The ratio of isolated myc-RAC1-GTP to total myc-RAC1 was then assessed using western blotting, probing for the myc-tag (Cell Signalling Technologies #2278), followed by a goat anti-rabbit HRP secondary (BioRad) and visualized using enhanced chemiluminescence.

Banka S., Bennington A., Baker M.J., Rijckmans E., Clemente G.D., Ansor N.M., Sito H., Prasad P., Anyane-Yeboa K., Badalato L., Dimitrov B., Fitzpatrick D., Hurst A.C., Jansen A.C., Kelly M.A., Krantz I., Rieubland C., Ross M., Rudy N.L., Sanz J., Stouffs K., Xu Z.L., Malliri A., Kazanietz M.G, & Millard T.H. (2022). Activating RAC1 variants in the switch II region cause a developmental syndrome and alter neuronal morphology. Brain, 145(12), 4232-4245.

+ Open protocol

+ Expand

Imaging Protein-RNA Interactions

Check if the same lab product or an alternative is used in the 5 most similar protocols

HeLa cells were transfected with plasmids expressing GFP, SRSF7-GFP and SRSF7_RRM-GFP using JetOPTIMUS Transfection Reagent (Polyplus) and were subsequently cultured for 20 h. Cells were lysed in NET-2 buffer supplemented with cOmplete Protease Inhibitor Cocktail (Sigma) and 10 mM β-glycerophosphate (Fluka BioChemica) and sonicated on ice for 30 s (see above). 25 µl Dynabeads Protein G (ThermoFisher Scientific, 10004D) were coupled with 2.5 µg goat α–GFP (provided by D. Drechsel, MPI-CBG) in NET-2 buffer while rotating for 2 h at 4 °C. Unbound antibody was removed by washing with NET-2 and high-salt buffer. Cleared lysates were added to the beads and incubated with rotation for 2 h at 4 °C. After washing with NET-2 buffer, the beads were resuspended in PBS and split into three tubes for addition of in vitro transcribed RNAs. RNAs were in vitro transcribed with HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs), purified, added to the beads at a final concentration of 100 ng µl⁻¹ and incubated with rotation for 10 min at 4 °C. Bead suspensions were diluted 1:10 in PBS, transferred to an eight-well glass chamber slide (Sarstedt) and imaged using a confocal laser microscope (Zeiss LSM780) as Z-stacks. FIJI was used to quantify the sizes of fluorescence bead aggregates using maximum projection and the ‘analyze particles’ option.

Königs V., de Oliveira Freitas Machado C., Arnold B., Blümel N., Solovyeva A., Löbbert S., Schafranek M., Ruiz De Los Mozos I., Wittig I., McNicoll F., Schulz M.H, & Müller-McNicoll M. (2020). SRSF7 maintains its homeostasis through the expression of Split-ORFs and nuclear body assembly. Nature Structural & Molecular Biology, 27(3), 260-273.

+ Open protocol

+ Expand

Generating Stable GFP-Tubulin and mCherry-H2B Cell Line

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

NAR cells were seeded in a six-well plate and transfected with Tubulin.GFP plasmid (Addgene plasmid #56450) with Jet Optimus transfection reagent (Polyplus #101000025). Enhanced green fluorescent protein (EGFP)–tubulin 6 was a gift from M. Davidson (Addgene plasmid #56450; http://n2t.net/addgene:56450; RRID:Addgene_56450) (35 (link)). After 48 hours, cells were sorted for GFP-positive cells in FACSAria. The cells with the highest GFP signal were selected for sorting. The cells were cultured with G418 (0.5 mg/ml) (Sigma-Aldrich, # 1720) for 2 weeks and resorted for GFP-positive cells. Next, cells were transfected with H2B.mCherry plasmid, gifted by R. Benezra (Addgene plasmid #20972; http://n2t.net/addgene:20972; RRID:Addgene_20972) (36 (link)), and sorted after 48 hours for GFP and mCherry double-positive cells. Cells were cultured in G418 for 1 week, and single-cell dilution was made in a 96-well plate. Single-cell clones were grown for 15 days with medium change every 3 days. Cell clones were monitored under a Nikon Eclipse Ti fluorescent microscope, and few of the clones with high tubulin.GFP and high H2B.mCherry were amplified and monitored. One of the best clones was used for further live-cell experiments.

Chatterjee S., Naidu G.S., Hazan-Halevy I., Grobe H., Ezra A., Sharma P., Goldsmith M., Ramishetti S., Sprinzak D., Zaidel-Bar R, & Peer D. (2023). Therapeutic gene silencing of CKAP5 leads to lethality in genetically unstable cancer cells. Science Advances, 9(14), eade4800.

+ Open protocol

+ Expand

Cetuximab Radiolabeling Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cetuximab (Cat# HY-P9905) was purchased from MedChemExpress (Monmouth, NJ, USA). The human IgG1 isotype (Cat# BE0297) was purchased from BioXCell (Lebanon, NH, USA) and used as a control. The jetOPTIMUS transfection reagent for transient transfection in cells was purchased from Polyplus (Alsace, Grand Est, France). The bifunctional chelating agent [(R)-2-Amino-3-(4-isothiocyanatephenyl) propyl]-trans-(S, S)-cyclohexane-1,2-diamine-pentaacetic acid (p-SCN-Bn-CHX-A-DTPA, Cat# B-355) was purchased from Macrocyclics Inc. (Richardson, TX, USA).

Kim D.M., Lee S.Y., Lim J.C., Cho E.H, & Park U.J. (2023). RUNX3 regulates the susceptibility against EGFR-targeted non-small cell lung cancer therapy using 47Sc-conjugated cetuximab. BMC Cancer, 23, 652.

+ Open protocol

+ Expand

Generation of HEK293F Stable Cell Lines Expressing αIIbβ3 and αvβ3 Integrins

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293F cells were grown in Dulbecco’s modified eagle medium (Capricorn Scientific, Ebsdorfergrund, Germany) supplemented with 10% fetal calf serum and 1% penicillin/streptomycin (PAN-Biotech, Aidenbach, Germany) and were transfected with β3 (wild-type or mutant) together with full-length wild-type αIIb or αv in pcDNA4/HisMax^©-TOPO^® Zeocin (Invitrogen) vector using jetOptimus Transfection reagent (Polyplus, Illkirch, France). After 4 weeks of cell culture in the presence of Geneticin (400 μg/mL) and Zeocin (200 μg/mL), cell lines were analyzed for αIIbβ3 and αvβ3 surface expression by flow cytometry. Stable transfectants expressing high αIIbβ3 and αvβ3 densities on the cell surface were sorted with Alexa Flour 488-labeled mAb Gi5 (anti-αIIbβ3 complex) using a BD FACSAria III with FACSDiva 6.1.3 software (Becton and Dickinson).

Holzwarth S.T., Bayat B., Zhu J., Phuangtham R., Fischer L., Boeckelmann D., Roeder L., Berghöfer H., Schmidt S., Bein G, & Santoso S. (2020). Naturally Occurring Point Mutation Cys460Trp Located in the I-EGF1 Domain of Integrin β3 Alters the Binding of Some anti-HPA-1a Antibodies. Transfusion, 60(9), 2097-2107.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!