Universal probe library upl

Following cDNA synthesis, samples were diluted with RNA-free water. For gene expression analysis, 1 μL of cDNA (10 ng) per reaction was used in a total volume of 10 μL. The reaction mix (per well) also included 5 μL of UPL ProbeMaster (Roche, Risch-Rotkreuz, Switzerland), 0.5 μM of forward and reverse primers (Genomed, Warsaw, Poland), and 0.2 μM of Universal Probe Library (UPL, Roche) hydrolysis probes for target gene PARP1 and three housekeeping genes POLR2A, PPIA, and GAPDH. All primers and probes were designed utilizing ProbeFinder Software (Roche), and their respective sequences as well as UPL probe numbers are listed in the table (Table 1). The real-time PCR was performed using a LightCycler 480 II (Roche Molecular Systems Inc., Indianapolis, IN, USA) instrument with following conditions: pre-incubation at 95 °C for 10 min, 50 cycles of amplification: 15 s at 95 °C for denaturation, 30 s at 60 °C for annealing, and 10 s at 72 °C for elongation, followed by cooling at 40 °C for 10 s. The measurements of the target gene were normalized to the geometric average of the values of all three housekeeping genes, and relative PARP1 gene expression was presented using the 2^−ΔΔCT method [34 (link)]. All gene expression analyses were performed in triplicate in the three independent experiments.

Total RNA was extracted and isolated from cells using miRCURY™RNA Isolation Kit (Exiqon, Denmark). RNA was then reverse transcribed to cDNA from 1μg of total RNA by using Transcriptor First Strand cDNA Synthesis Kit (Roche). Real time-PCR was then performed in Light Cycler®480 (Roche) using Master Probes Kit (Roche) and Universal Probe Library (UPL) (Roche). All protocols were performed according to the manufacturer's instructions.
RT-PCR was performed using the following primers and UPLs: ER alpha, UPL probe #17, left primer: ATCCACCTGATGGCCAAG, right primer: GCTCCATGCCTTTGTTACTCA; SOX-2, UPL probe #35, left primer: TTGCTGCCTCT TTAAGACTAGGA, right primer: CTGGGGCTCAAACT TCTCTC; Oct-4, UPL probe #35, left primer: AG CAAAACCCGGAGGAGT, right primer: CCACATCG GCCTGTGTATATC; MDR1, UPL probe #7, left primer: CAAGCATCTGCCAAAACCTC, right primer: CTGGGTTTCCCCCTGTAAAT; BCRP1, UPL probe #56, left primer: TGGCTTAGACTCAAGCACAGC, right primer: TCGTCCCTGCTTAGACATCC, Nanog, UPL probe #69, left primer: ATGCCTCACACGGAGACTGT, right primer: AGGGCTGTCCTGAATAAGCA; GAPDH, UPL probe #45, left primer: TCCACTGGCGTCTTCACC, right primer: GGCAGAGATGATGACCCTTTT. GAPDH was used as internal control. The results were analyzed using comparative threshold cycle (ΔΔCT method).

Total RNA was extracted using the High Pure RNA isolation kit (Roche, Mannheim, Germany), according to the manufacturer’s instructions. PCR without reverse transcriptase confirmed the absence of DNA. Templates of 100 ng of total RNA were used in the target gene studies. Real-time PCR analysis of gene expression was performed in duplicate with specific internal oligonucleotide primers and the TaqMan probe (Universal ProbeLibrary-UPL, Roche, Mannheim, Germany). All primers and UPL probes used in the RT-PCR study are shown in Additional file 4.

Total RNA was isolated and DNaseI‐treated from self‐renewing hESCs and day 44 mDA neurons with the MasterPure^™ Complete DNA and RNA Purification Kit (Epicentre) following the manufacturer's instructions. cDNA was synthesized from 500 ng of total RNA using the SuperScript^™ IV Reverse Transcriptase (Thermo Fisher Scientific). qPCR was performed using the Roche LightCycler^® 480 System with the Universal Probe Library (UPL) (Roche). The Roche UPL Assay design centre was used to design intron‐spanning primers with a specific UPL Probe for each gene (TBP F‐gaacatcatggatcagaacaaca R‐atagggattccgggagtcat Probe 87; NANOG F‐tctccaacatcctgaacctca R‐ttgctattcttcggccagtt Probe 87; OCT4 F‐tgccgtgaaactggagaag, R‐gcttggcaaattgttcgagt Probe 78; DAT F‐ agactgcccgaagtgtgc, R‐gcagtttcccgttacaccaa Probe 14; NURR1 F‐atttcctcgaaaacgcctgt, R‐catactgcgcctgaacacaa Probe 41; SOX6 F‐gcttctggactcagcccttta, R‐ggccctttagcctttggtta Probe 50; VMAT2 F‐cgggattctgcatcatgttt, R‐tggcaatcagcaggaagg Probe 67). Reactions (10 μl) containing cDNA, primers, UPL Probe, LightCycler^® 480 Probes Master mix (Roche) and PCR water were performed in 386‐well plates as described in the manufacturer's instructions. The data were normalized to levels of TATA‐binding protein (TBP) and the data of technical replicates were plotted.

Isolated total RNA was reverse transcribed with the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, U.S.A.). Quantitative real-time polymerase chain reaction (PCR) was performed using Realtime PCR Master Mix (Applied Biosystems) and the Universal Probe Library (UPL; Roche Life Science, Penzberg, Germany) in a final volume of 10 μl. Real-time PCR assays were performed using a CFX384 Touch Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, U.S.A.).

RNA was extracted from potato leaves and tubers as described (Ducreux et al., 2008). The first‐strand cDNA templates were generated by reverse transcription, using random hexamers as primer and SuperScript II reverse transcriptase (Invitrogen Life Technologies, Carlsbad, CA). Potato elongation factor1‐alpha (EF1α) primers were used as a control. The expression level of HSc70 was analysed using the StepOnePlus Real‐Time PCR system (Applied Biosystems) and StepOne Software version 2.3 (Applied Biosystems, Foster City, CA, USA). Gene‐specific primers and Universal probe Library (UPL, Roche Life Science) probes (Table S2) were used at a concentration of 0.2 and 0.1 μm, respectively. Thermal cycling conditions were as follows: 10‐min denaturation at 95 °C followed by 40 cycles of 15 s at 94 °C, 60 s at 60 °C. Relative expression levels were calculated and the primers validated using the Ct method (Livak, 1997). To normalize the values, an alternative method for calculating relative quantification was used (Pfaffl, 2001). The HSc70 expression level in transgenic lines was determined using the same method.