For the luciferase assay, HEK293T cells in a 96-well format were transfected with 50 ng per well PNFAT-luc2P (pGL4.30[luc2P/NFAT RE/]; Promega), 50 ng per well PSV40-hRluc (pRL-SV40; Promega) and 0–10 ng per well various Ca2+ photoswitch constructs, and incubated for 23 h. hRluc (Renilla luciferase) activity was used as an internal control for cell viability and transfection efficiency. After the medium was replaced with MEM supplemented with 10% FBS containing 10 ng ml−1 PMA, the cells were either illuminated with a 470-nm LED light (60 μW mm−2) or not illuminated, for 6 h in CO2 incubators. The firefly and Renilla luciferase activities were quantified using a Dual-Glo Luciferase assay system (Promega). Luminescence was measured using an ARVO X5 (PerkinElmer). For YFP induction, HEK293T cells in a glass-bottomed 35-mm dish with four compartments (Greiner Bio-One) were transfected with 1 μg per well pHY41 and 500 ng per well dmBACCS2-IRES-dOrai, and incubated for 24 h. The medium was then replaced with MEM supplemented with 10% FBS containing 10 ng ml−1 PMA, and the cells were either illuminated with a 470-nm LED light (60 μW mm−2) for 12 h or not illuminated, in CO2 incubators. YFP expression was observed using the FV1200 laser scanning microscope.
Arvo x5
Manufactured by PerkinElmer
Sourced in United States
The ARVO X5 is a multi-mode microplate reader designed for a variety of absorbance, fluorescence, and luminescence-based assays. It features a xenon flash lamp, a high-performance detection system, and supports temperature control up to 65°C. The ARVO X5 can be used for a wide range of applications in life science research and drug discovery.
Automatically generated - may contain errors
Lab products found in correlation
Pgl4.20 luc2 puro vector, by Promega (2 mentions)
Lance ultra camp kit, by PerkinElmer (2 mentions)
Cell counting kit 8 (cck8), by Dojindo Laboratories (2 mentions)
Bca protein assay kit, by Thermo Fisher Scientific (2 mentions)
Dual glo luciferase assay system, by Promega (1 mentions)
Oxygen consumption rate assay kit, by Cayman Chemical (1 mentions)
Polyethylenimine (pei), by Merck Group (1 mentions)
Staurosporine, by Cayman Chemical (1 mentions)
Caspase glo 3 7 assay, by Promega (1 mentions)
Arvo x3, by PerkinElmer (1 mentions)
Oxiselect intracellular ros assay kit, by Cell Biolabs (1 mentions)
O phenylenediamine dihydrochloride, by Merck Group (1 mentions)
Hrp conjugated anti rabbit igg, by Southern Biotech (1 mentions)
Tween 20, by Merck Group (1 mentions)
Bovine serum albumin (bsa), by Merck Group (1 mentions)
384 well plate, by Greiner (1 mentions)
Imark microplate absorbance reader, by Bio-Rad (1 mentions)
Ca 50, by Sysmex (1 mentions)
Thrombocheck aptt sla, by Sysmex (1 mentions)
Nadp nadph extraction buffer, by Abcam (1 mentions)
18 protocols using arvo x5
1
Optogenetic Regulation of NFAT and YFP
2
Survivin Promoter Activity Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The presumptive promoter region of survivin (−1,500 to 0 bp of the transcription start site [TSS]) was cloned from the genomic DNA of KP-MRT-YM cells using the following primers: F, 5′-AGCCAATCAGCAGGACCCAGG-3′; and R, 5′-GGTCCCGCGATTCAAATCTGGC-3′, and then subcloned into the pGL4.20 (luc2/Puro) vector (Promega, USA). Both pGL4.20 inserted survivin promoter vector and pRL-CMV control vector (Toyobo B-Net, Japan) were co-transfected into HEK293T cells that stably express shRNA of sh_Luc or expression vector of RUNX1. Promoter activity was measured using the PicaGene Dual Sea Pansy Luminescence Kit (Toyobo B-Net) and ARVO X5 (Perkin Elmer, USA).
3
Oxygen Consumption Rate Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oxygen consumption rate was measured using an Oxygen Consumption Rate Assay Kit (Cayman Chemical, Ann Arbor, MI) according to the manufacturer’s protocol. Briefly, 2.0 × 104 pre-cultured cells in 96-well plates were incubated overnight at 37 °C. The medium was then replaced with 160 µL of fresh medium, and a phosphorescent probe was added to measure the oxygen consumption. Each well was sealed with 100 µL of mineral oil to prevent oxygen diffusion. The signals were measured by an ARVO X5 plate reader (PerkinElmer Japan, Kanagawa, Japan) using time-resolved mode at Ex 380 nm and Em 650 nm for 210 min at 1-min intervals. Linear regression was performed after subtracting the blank, and the oxygen consumption rate was indicated by the slope of each signal profile.
4
Quantifying A2A Receptor Activation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Activation of A2ARs was quantified on the basis of cAMP accumulation in CHO cells expressing mouse A2ARs. CHO cells were suspended in Hank’s balanced salt solution (HBSS) containing 1M HEPES and 0.25M 3-isobutyl-1-methylxanthine in 384-well micro-plates (2×103 cells/well) and incubated with adenosine and A2AR PAM-1 or A2ARPAM-2 at the indicated concentrations for 30 min at 25°C. After adding the detection mixture containing the Eu-cAMP tracer and ULight-anti-cAMP antibody, the plates were further incubated for 1 h at 25°C. A microplate reader (ARVO X5, PerkinElmer, Waltham, MA; excitation: 340 nm; emission: 665 nm) was used to measure the Förster resonance energy transfer (FRET) signal. All experiments were performed according to the manufacturer’s instructions (LANCE Ultra cAMP Kit, PerkinElmer). The cAMP levels are based on the dynamic range (“linear portion”) of the cAMP standard curve and normalized to the baseline or adenosine-treated group.
5
Quantifying A2A Receptor Activation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Activation of A2ARs was quantified based on cAMP accumulation in CHO cells expressing mouse A2ARs generated in a previous study9 (link). CHO cells were suspended in Hank’s balanced salt solution containing 1 M HEPES and 0.25 M 3-isobutyl-1-methylxanthine in 384-well micro-plates (2 × 103 cells/well) and incubated with adenosine and A2ARPAM-1 or optoA2ARPAM-1 after light irradiation for the indicated time for 30 min at 25 °C. After adding the detection mixture containing the Eu-cAMP tracer and ULight-anti-cAMP antibody, the plates were further incubated for 1 h at 25°C. A microplate reader (ARVO X5, PerkinElmer; excitation: 340 nm; emission: 665 nm) was used to measure the Förster resonance energy transfer signal. All experiments were performed according to the manufacturer’s instructions (LANCE Ultra cAMP Kit, PerkinElmer). The cAMP levels are based on the dynamic range (“linear portion”) of the cAMP standard curve and normalized to the baseline or adenosine-treated group.
6
BCR Promoter Activation in HEK293T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T cells were seeded in 10 mL DMEM supplemented with 10% heat‐inactivated FBS and 1% PS 1 d before transfection. Cells were transfected with 10 µg of pGL4.20 harboring the BCR promoter and 1 µg pRL‐CMV with polyethylenimine (PEI; Sigma‐Aldrich). The BCR promoter region was amplified from the genomic DNA of SU/SR cells using specific primers (F 5′‐TTAGAGGGAGGCTAATCAGGG‐3′ and R 5′‐TCCTCGGACGCTAAGCTC‐3′). At 24 h after transfection, doxycycline was added at 3 µmol L−1 and incubated for another 24 h. The cells were then rinsed twice with PBS and lysed with 1× lysis buffer as supplied in the PicaGene® Dual Sea Pansy Luminescence kit (TOYO B‐net). The luciferase and Renilla luciferase activity were measured using ARVO X5 (PerkinElmer).
7
Caspase-3/7 Activity Assay in HMC-1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HMC-1 cells (1×105 cells/ml) were cultured in the presence and absence of 0.5 µM rhGal-9 or 0.1 µM staurosporine (Cayman Chemical Company, Ann Arbor, MI, USA) at 37°C for 16 hours. Then the caspase-3/7 activities in the cells were determined by Caspase-Glo 3/7 assay (Promega, Madison, WI, USA) in accordance with the manufacturer’s instructions. The luminescence (Relative Light Unit [RLU]) of each sample was measured with a fluorescence plate reader (ARVO X5, PerkinElmer, Waltham, MA, USA) at 490/535 nm.
8
Measuring Cell Viability using WST-8
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
9
Quantifying Intracellular ROS Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The generation of intracellular ROS during t-PDT was measured using an OxiSelect Intracellular ROS assay kit (Cell Biolabs, Inc., San Diego, CA, USA), which uses the oxidation-sensitive fluorescent probe 2′,7′-dichlorodihydrofluorescein diacetate (DCFH-DA). This assay was performed by adding DCFH-DA to TE-11R cells 4 h after t-PDT and quantifying intracellular ROS levels by detecting oxidized fluorescent 2′,7′-dichlorodihydrofluorescein (DCF) using a fluorometric plate reader (ARVO X5; PerkinElmer, Waltham, MA, USA) at 480/530 nm.
10
Quantification of HPV-L1 Antibodies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
F96 Maxisorp Nunc-Immuno plates (Themo Fisher Scientific, MA, USA) were coated with purified HPV-L1 recombinant proteins or Cervarix® in 50 mM carbonate buffer (pH 9.6) at 4°C overnight. After blocking with PBS containing 1% BSA (Sigma-Aldrich, MO, USA), 1,000-fold diluted two rabbit polyclonal antisera to Cervarix®, was added and incubated at room temperature (r.t.) for 1 h. After washing the wells 3 times with PBS containing 0.1% Tween 20 (Sigma-Aldrich), HRP-conjugated anti-rabbit IgG (Southern Biotech, AL, USA) was added and incubated at room temperature (r.t.) for 1 h. After washing the wells 3 times, o-phenylenediamine dihydrochloride (Sigma-Aldrich) was added to the wells and incubated for 5 min at r.t., followed by the addition of 1 M H2SO4. The absorbance was measured at 490 nm using the ARVO X5 (Perkin Elmer, MA, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!