The DGK-θ kinase assay was performed using a recently developed NBD-based fluorescence assay (18 ). Briefly, NBD-DAG was produced by phospholipase C-mediated hydrolysis of NBD-PtdCho as described (18 ). Purified DGK-θ was incubated with 3 mM brain liposomes supplemented with NBD-DAG (at 6% of the total DAG), 1 mM ATP, and 1.5 mM MgCl2, with or without 0.02 μg/μl Syt-1 (total reaction volume was 50 μl) at 37°C for 20 min. The reactions were stopped by adding 100 μl of methanol followed by a Bligh-Dyer extraction of total lipids. The organic phase was dried under nitrogen. To separate the NBD-PtdOH from the NBD-DAG, the dried lipids were solubilized in chloroform:methanol (2:1 v/v), spotted on a silica gel 60 TLC plate, and developed using chloroform: methanol: 80% acetic acid (65:15:5 v/v). The NBD-PtdOH generated in the kinase reaction was scanned by Typhoon RGB (Cytiva Life Sciences) and quantified by ImageJ software. In all assays, a standard curve of NBD-PtdOH was used for quantification. A blank region of the TLC plate was quantified and used as a background which was subtracted from all samples.
Typhoon rgb
Manufactured by Cytiva
The Typhoon RGB is a multipurpose fluorescence and phosphorescence imager designed for a wide range of applications in life science research. It offers high sensitivity and dynamic range for the detection and quantification of proteins, nucleic acids, and other biomolecules labeled with a variety of fluorescent dyes or radiolabels.
Automatically generated - may contain errors
Lab products found in correlation
9 protocols using typhoon rgb
1
DGK-θ Kinase Activity Assay
2
Quantitative Northern Blot Analysis of gRNA
3
Pseudouridylation Detection Protocol
4
Quantifying Fungal Hydrogen Sulfide Production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The potential hydrogen sulfide-producing strains were cultured on MTB agar for 3–5 days. Fungal colonies were observed on the plates at 32 °C; then, the plates were divided into three regions, and DDX-DNP (25 μM) was sprayed on to the fungal colonies and incubated for 4 h at 32 °C. The inhibitor group were preincubated with AOA (1 mM) for 2 h at 32 °C. Finally, the plates were scanned using an Amersham Typhoon RGB (λex = 532 nm).
Candida albicans and negative strains were cultured in the MTB medium; then,DDX-DNP was added into the medium with a final concentration of 25 μM and incubated at 32 °C for 4 h. The inhibitor group were preincubated with AOA (1 mM) for 2 h at 32 °C. After washing the whole cells three times with PBS, they were dropped into glass slides and immobilized with coverslips for imaging experiments. Finally, the imaging cells were observed using a Leica Confocal Microscope with λex 561/λem 602–650 nm. The fluorescent signal was also recorded using flow cytometry. A total of about 10,000 events were collected for data analysis, without using specific gating policies. The data were analyzed using FlowJoversion v10.8.1 software.
Candida albicans and negative strains were cultured in the MTB medium; then,
5
Selective RNA Cleavage by cASO-CB Complex
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Before the RNA cleavage assay, cASOTCTP-CB was mixed with 1 μg/mL CB at 37°C for 1 h. Then, the 46-mer Cy3-labeled target RNA (Cy3-RNA) truncated from TCTP mRNA was incubated with CB -cleaved cASOTCTP-CB and cASOTCTP-CB as well as positive control lASOTCTP in 1× RNase H1 buffer (20 mM Tris-HCl, 20 mM KCl, 10 mM MgCl2, 0.1 mM EDTA, and 0.1 mM dithiothreitol [pH 8.0]) at a concentration of 4 μM RNA and 0.1 μM ASO at 37°C for 20 min. Then, RNase H1 was added to the above mixture solution at a final concentration of 0.5 U/μL. 2 μL reaction solution was allocated each time at four time points (10, 25, 40, and 60 min) and quenched and analyzed in 20% denaturing PAGE gels (Figure S6 ). The signal of Cy3-RNA and its cleaved bands was detected upon excitation at 488 nm using Amersham Typhoon RGB. The gray quantitative of the Cy3 signal was analyzed using ImageJ software.
6
Fungal Identification via Fluorescent Tagging
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fresh human stools were dispersed in sterile water
and coated on to a potato agar plate, which was cultured at 32 °C
for about 5 days until the development of obvious fungal colonies.
The potato agar plate contained penicillin (100 U/mL)/streptomycin
(0.1 mg/mL), to inhibit intestinal bacteria. Then,DDAO-C6 (100 μM) was sprayed on these colonies and incubated at 32
°C for 2 h. The plates were then imaged using an Amersham Typhoon
RGB, and the fluorescence images recorded (λex =
635 nm, λem = 670 ± 15 nm). Then, the colonies
exhibiting fluorescence emission were purified and identified by the
intergenic internal transcribed spacer 1 (ITS1) region sequencing
using paired universal primers ITS1 (TCCGTAGGTGAACCTGCGG)/ITS2(GCTGCGTTCTTCATCGATGC),
respectively.
and coated on to a potato agar plate, which was cultured at 32 °C
for about 5 days until the development of obvious fungal colonies.
The potato agar plate contained penicillin (100 U/mL)/streptomycin
(0.1 mg/mL), to inhibit intestinal bacteria. Then,
°C for 2 h. The plates were then imaged using an Amersham Typhoon
RGB, and the fluorescence images recorded (λex =
635 nm, λem = 670 ± 15 nm). Then, the colonies
exhibiting fluorescence emission were purified and identified by the
intergenic internal transcribed spacer 1 (ITS1) region sequencing
using paired universal primers ITS1 (TCCGTAGGTGAACCTGCGG)/ITS2(GCTGCGTTCTTCATCGATGC),
respectively.
7
Fluorescent Stem-Loop Substrate Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A stem-loop substrate (GCCAGCGCTCGG(T)22CCGAGCGCTGGC) containing fluorescent dye Cy5 (50 pmol) at 3′ terminus (IDT) was annealed in a 100-µl annealing buffer (10 mM Tris, pH 7.5, and 50 mM NaCl) by heating at 95°C for 5 min and slowly cooling down over a period of 2 h. 200 fmol of annealed substrate was used in 20-µl reactions containing 25 mM Hepes, pH 8.0, 2 mM MgCl2, 10% glycerol, 0.5 mM β-mercaptoethanol, 0.1 mg/ml BSA, 40 mM NaCl, and 0–40 nM of protein. The reactions were incubated at 30°C for 30 min and stopped by adding 10 µl 90% formamide/10 mM EDTA. After heating at 95°C for 5 min and cooling on ice, 15 µl of each sample was loaded on a 15% denaturing polyacrylamide gel. Gels were run at 30 mA for 30 min and bands visualized by fluorescence by Typhoon RGB (Amersham Biosciences).
8
High-Throughput Screening for PGP-1 Inhibitors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The high throughput screening for PGP-1 inhibitors were performed in 96-well plates by the co-incubation about PGP-1 (0.05 μg/mL), DDPA (10 μM) and various herb extracts (1 μg/mL) with the same enzymatic reaction conditions as mentioned above.
The herbs used are listed in Table S1. Then, the plate was subjected to fluorescence imaging (λex = 635 nm, λem = 670 ± 15 nm) using an Amersham Typhoon RGB.
According to the fluorescence intensity of individual wells, the inhibitory effect of each herb was determined. The inhibitory effect of isolated compounds was evaluated using the same protocol.
The herbs used are listed in Table S1. Then, the plate was subjected to fluorescence imaging (λex = 635 nm, λem = 670 ± 15 nm) using an Amersham Typhoon RGB.
According to the fluorescence intensity of individual wells, the inhibitory effect of each herb was determined. The inhibitory effect of isolated compounds was evaluated using the same protocol.
9
Isolation and Identification of Gut Bacteria
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human stools of healthy subject were collected from Dalian Medical University.
The fresh stools were dispersed in sterile water immediately, which was then cultured on nutrient broth agar medium (NB) until the formation of obvious colonies (37 ºC, 48 h). When the bacterial colonies were observed on the agar plates, DDPA was dropped onto the bacterial colonies for a co-incubation of 5 h. Then, fluorescence images of the agar plates were obtained using an Amersham Typhoon RGB (λex 635 nm, λem 670 ± 15 nm). For the bacterial colonies with strong fluorescence intensity, a further purification was performed on the NB culture. The isolated bacteria strains were identified by 16s rDNA sequence. The RT-PCR primers were as follows.
1510 R: 5'-ACGGYTACCTTGTTACGACTT-3' 7F: 5'-AGAGTTTGATYMTGGCTCAG-3'
The fresh stools were dispersed in sterile water immediately, which was then cultured on nutrient broth agar medium (NB) until the formation of obvious colonies (37 ºC, 48 h). When the bacterial colonies were observed on the agar plates, DDPA was dropped onto the bacterial colonies for a co-incubation of 5 h. Then, fluorescence images of the agar plates were obtained using an Amersham Typhoon RGB (λex 635 nm, λem 670 ± 15 nm). For the bacterial colonies with strong fluorescence intensity, a further purification was performed on the NB culture. The isolated bacteria strains were identified by 16s rDNA sequence. The RT-PCR primers were as follows.
1510 R: 5'-ACGGYTACCTTGTTACGACTT-3' 7F: 5'-AGAGTTTGATYMTGGCTCAG-3'
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!