Realtime ready assay

Total RNA was isolated by using the RNeasy Plus mini kit (Qiagen). Total RNA was reverse transcribed into cDNA using the GoScript Reverse Transcription System (Promega). cDNA samples were amplified using the Lightcycler Nano (Roche Diagnostics) and Faststart Essential DNA Probes Master System (Roche Diagnostics) with RealTime Ready Assays (Roche Diagnostics) or Universal Probes (Sigma Aldrich). Expression of RORC was normalised to the expression of the reference gene, GAPDH. The chosen RORC assay (Assay ID: 102571) detected both variants of RORC (ROR-γ and ROR-γ). The fold change in gene expression was calculated using the equation: 2^(-ΔΔCq). The primer sequences for nucleoprotein (NP) were as follows: H1N1 NP forward: GGTGCTGCAGTCAAAGGAGT; reverse: CCCACGTTTGATCATTCTGA; H3N2 NP forward: GGTGCTGCAGTCAAAGGAAT; H3N2 NP reverse: CCCCGTTTGACCATTCTG. NP primers were used with a universal probe (4694414001).

Basal and irradiation-induced p21 expression levels, as read-out for p53 transcriptional activity in HNSCC cell lines, as well as basal EGFR levels were determined by quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR). Total cellular RNA extraction was performed using the High Pure RNA Isolation Kit (Roche, Basel, Switzerland). Synthesis of cDNA was done with the Omniscript Reverse Transcription kit (QIAGEN, Hamburg, Germany), according to the supplied protocol, using random hexamers and oligo dT15 primers (Roche) and 2 μg of total RNA. The quality of RNA was checked by GAPDH PCR and only samples positive for GAPDH transcripts were used for analysis. Real-time-PCR was performed in a reaction volume of 20 μl containing 2 μl cDNA, Light Cycler TaqMan Master (Roche), primers and probes for p21, EGFR and the housekeeping gene porphobilinogen deaminase (PBGD) in concentrations recommended by the manufacturer (Real Time Ready Assays, Roche). PCR cycling was performed using a Light Cycler (Roche). Relative quantification of p21 and EGFR expression was done by normalization to the expression levels of PBGD.

Total RNA was isolated by using either the RNeasy mini kit (Qiagen), including DNase digestion (RNase-free DNase kit; Qiagen) or the RNeasy Plus mini kit (Qiagen). Total RNA was reverse transcribed into cDNA (GoScript Reverse Transcription System; Promega). cDNA samples were amplified using the Lightcycler Nano (Roche Diagnostics) and Faststart Essential DNA Probes Master System (Roche Diagnostics) with RealTime Ready Assays (Roche Diagnostics). Expression of IFN-α (Assay ID: 145795), IFN-β (Assay ID: 145797), and GAPDH. The chosen IFN-α probes detect a sequence which is common to all IFN-α subtypes. Gene expression was normalised to expression of the reference gene GAPDH.

Neurospheroids were distributed in precoated 12‐well plates. Total RNA was extracted from neurospheroids with High Pure RNA Isolation kit (Roche) and quantified using NanoRop 2000c (ThermoScientific). Reverse transcription was performed with Transcriptor High Fidelity cDNA Synthesis kit (Roche), and qPCR analysis was performed as described.^[68] List of primers used and sequences is presented in Table S1, Supporting Information. RealTime ready assays from Universal Probe Library (Roche) were used with forward and reverse primers (400 nM) and fluorescently labeled hydrolysis probes (200 nM) lyophilized in a Custom Panel 384 (configuration no. 100127094, Roche, Table S2, Supporting Information), performed according to manufacturer's instructions. Results were processed using the 2^–∆∆CT method for relative gene expression analysis. Changes in gene expression were normalized using the housekeeping genes RPL22, in the case of RT‐qPCR, and GAPDH, B2M, and ACTB, in the case of RealTime Ready assay.

As read-out for p53 transcriptional activity in SCCHN cell lines, basal and irradiation-induced p21 expression levels were determined by quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR). Total cellular RNA extraction was performed using the High-Pure RNA Isolation kit (Roche Diagnostics, Mannheim, Germany). Synthesis of cDNA was done with the ‘Omniscript Reverse Transcription kit’ (QIAGEN, Hilden, Germany) according to the supplied protocol using random hexamers and oligo dT15 primers (Roche, Basel, Switzerland) and 2 µg of total RNA.
The quality of RNA was checked by GAPDH PCR and only samples positive for GAPDH transcripts were used for analysis. Realtime PCR was performed in a reaction volume of 20 µl containing 2 µl cDNA, Light Cycler TaqMan Master (Roche), primers and probes for p21 and the housekeeping gene porphobilinogen deaminase (PBGD) in concentrations recommended by the manufacturer (Real Time Ready Assays, Roche). PCR cycling was performed using the Light Cycler 480 II (Roche). Relative quantification of p21 expression was done by normalization to the expression levels of PBGD using the ΔC_t-method.