HA-SPAR was a gift from Dr. D. Pak, Georgetown University, Washington, DC. Flag-Prosapip1 was cloned by high fidelity PCR using XhoI-Flag-Prosapip1 forward primer and XbaI-reverse primer and inserted into a modified form of the plvx-IRES-Zsgreen vector (Clontech, Cat. 632187) were Zsgreen has been replaced by GFP to obtain plvx-Flag-Prosapip1-IRES-GFP. To target Prosapip1 by shRNA, the 19 nucleotides short hairpin RNA (shRNA) sequence 5′-GGG AAG AGC TGG AGG ACA A-3′ targeting Prosapip1 (shProsapip1) was selected using siRNA Wizard v3.1 (InvivoGen, San Diego, CA). The scramble 19 nucleotides sequence 5′-GCG CTT AGC TGT AGG ATT C-3′ was used as a control (SCR). Synthesized DNA oligos containing the above sequences were annealed and inserted into pLL3.7 vector (Addgene, Cambridge, MA) at HpaI and XhoI sites. Plasmids DNA were prepared using a Plasmid Maxi Kit (Qiagen, Germantown, MD). All constructs were verified by sequencing.
Plvx ires zsgreen vector
Manufactured by Takara Bio
Sourced in United States
The PLVX-IRES-ZsGreen vector is a lentiviral expression vector that enables the expression of a gene of interest along with the green fluorescent protein ZsGreen. The vector contains an internal ribosome entry site (IRES) sequence that allows for the translation of two separate proteins from a single mRNA transcript.
Automatically generated - may contain errors
Lab products found in correlation
Endofree maxiprep kit, by Qiagen (2 mentions)
Cacl2, by Merck Group (2 mentions)
Endofree plasmid kit, by Qiagen (2 mentions)
Sirna wizard v3, by InvivoGen (1 mentions)
Pll3.7 vector, by Addgene (1 mentions)
Plasmid maxi kit, by Qiagen (1 mentions)
Lenti x p24 rapid titer kit, by Takara Bio (1 mentions)
Polybrene, by Merck Group (1 mentions)
Polyethylenimine (pei), by Merck Group (1 mentions)
Bamh1, by New England Biolabs (1 mentions)
Ecori, by New England Biolabs (1 mentions)
Interferin transfection reagent, by Polyplus Transfection (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Phusion high fidelity dna polymerase, by Thermo Fisher Scientific (1 mentions)
Pcdna4 to vector, by Thermo Fisher Scientific (1 mentions)
Zeocin, by InvivoGen (1 mentions)
High fidelity polymerase phusion enzyme, by New England Biolabs (1 mentions)
Phusion site directed mutagenesis kit, by Thermo Fisher Scientific (1 mentions)
Pgl3 control vector, by Promega (1 mentions)
Hilymax transfection reagent, by Dojindo Laboratories (1 mentions)
11 protocols using plvx ires zsgreen vector
1
Prosapip1 shRNA Construction and Cloning
2
Lentiviral-Mediated Overexpression of Antiviral Factors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviral vectors expressing IFITM1, IFITM2, and IFITM3 were purchased from GENECHEM (Shanghai, China). The Mx1 and Mx2 expression plasmids were a kind gift from Dr. Malim MH (Goujon et al., 2013 (link)), and the DExD/H box helicase expression plasmids were kindly provided by Yasuo Ariumi (Yasuda-Inoue et al., 2013 (link)). All cDNAs were subsequently subcloned into the pLVX-IRES-ZsGreen vector (Clontech, Mountain View, CA, USA) using the Xho I and BamH I restriction sites.
To generate specific ISGs (IFN stimulated genes) or DExD/H box helicase molecule-expressing lentiviruses, pLVX-ISG was co-transfected with the lentivirus packing plasmids psPAX2 and pMD2.G (a gift from Didier Trono, Addgene plasmid #12260 and #12259) using PEI (Sigma-Aldrich) in HEK293 (293T) cells. Six hours later, the culture flask was replenished with fresh medium; the supernatants containing the lentiviruses were collected 24 and 48 h after transfection and combined. The viral titers were determined using the Lenti-X p24 Rapid Titer Kit (Clontech) according to the manufacturer's protocol. For lentiviral infection, the cells were infected with a lentivirus supplemented with 8 μg/ml of polybrene (Sigma-Aldrich) for 12 h and then incubated with fresh medium. The cells were challenged with HTNV 24 h after lentiviral infection and then fixed at 2 days post infection for ICW to detect HTNV NP expression.
To generate specific ISGs (IFN stimulated genes) or DExD/H box helicase molecule-expressing lentiviruses, pLVX-ISG was co-transfected with the lentivirus packing plasmids psPAX2 and pMD2.G (a gift from Didier Trono, Addgene plasmid #12260 and #12259) using PEI (Sigma-Aldrich) in HEK293 (293T) cells. Six hours later, the culture flask was replenished with fresh medium; the supernatants containing the lentiviruses were collected 24 and 48 h after transfection and combined. The viral titers were determined using the Lenti-X p24 Rapid Titer Kit (Clontech) according to the manufacturer's protocol. For lentiviral infection, the cells were infected with a lentivirus supplemented with 8 μg/ml of polybrene (Sigma-Aldrich) for 12 h and then incubated with fresh medium. The cells were challenged with HTNV 24 h after lentiviral infection and then fixed at 2 days post infection for ICW to detect HTNV NP expression.
3
Lentiviral Vector Production Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Briefly, an approximately 250 bp fragment containing the human MT-3 gene was directly synthesized, and cloned into the pMD18-T vector. Positive clones were confirmed by sequencing and subcloned into the pLVX-IRES-ZsGreen vector (Clontech). The vector plasmids, pLVX-IRES-ZsGreen1, pLP1, pLP2 and pLP/VSVG were amplified in E.Coli and purified using the Endofree Maxiprep Kit (Qiagen). 270 μg of transfer vector, 176 μg of pLP1, 95 μg of pLP/VSVG and 68 μg of pLP2 was mixed with 0.25 M CaCl2 (Sigma) and added to same volume of 2 × HEPES (Sigma) and mixed while bubbling for 20 min to allow a precipitate to form. This was then added to a 175 cm2 flask of approximately 60% confluent 293 T cells containing 20 mL DMEM supplemented with 10% fetal calf serum, 100 U/mL penicillin, 100 μg/mL streptomycin and 2 mM glutamine and incubated for 48 h at 37°C in 5% CO2. The supernatant was centrifuged at 1,700 g for 10 min to pellet cell debris, and ultracentrifuged at 121,603 g for 2 h. The pellet containing concentrated virus was resuspended in DMEM without supplements and stored at -80°C.
4
Constructing Plasmids for lincRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids expression vectors containing GFP and the MIR503HG2 or LINC00629 full-length sequence were constructed using pLVX-IRES-ZsGreen Vector (Clontech, Catalog No. 632187, modified for restriction enzymes positions), EcoRI and BamH1 restriction enzymes (New England BioLabs Catalog No. R0101S and R0136S, respectively). We used cDNA derived from placenta tissue from a panel of 20 normal tissues RNA (FirstChoice Human Total RNA Panel Survey, Ambion, Catalog No. AM6000) to generate the lincRNAs full sequences. We used the following pair of primers to amplify MIR503HG2: MIR F: 5’ GGATCCGCTCCCCGCGAGGCCGGCT 3’ and MIR R: 5’ GAATTCGGACAGTTGCCC ATATTAAC 3’, and LINC F 5’ GGATCCACTGGGCGCCCAGAGTAA 3’ and LINC R 5’ GAATTCGAGAGTGACTTG CAGTCTTGTG 3’ to amplify LINC00629 three-exon isoform (LINC00629C or LINC00629D).
5
Constructing FXR1 and GDF-15 Overexpression Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate the FXR1 overexpression construct, the coding sequence (CDS) of human FXR1 (NM_005087.4) was cloned into the pLvx-IRES-ZsGreen vector (Clontech Laboratories). To generate a construct overexpressing GDF-15, the CDS of human GDF-15(NM_004864.4) was cloned into the GV365 vector. We used the INTERFERin Transfection Reagent (Polyplus) to transfect pLvx-IRES-ZsGreen-FXR1, pCMV-GDF-15, and the control vector into cells.
6
Overexpression of Transcription Factor YY1 via Lentiviral Vectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate a construct overexpressing YY1, the coding region sequence (CDS) of human YY1 was cloned into the pLVX‐IRES‐ZsGreen vector (Clontech Laboratories, Mountain View, CA, USA) using the primers CDS F: 5′‐ATTGAATTCGAGCCCTCAGCCATGGCCT‐3′ and R: 5′‐GCGCGGATCCCTCTTCTTTTCACTGGTTGT‐3′. All constructs were verified by sequencing (Life Technologies, New York, USA). The PLVX‐IRES‐ZsGreen‐YY1 construct and the control vector were purified using an Endofree Plasmid kit (Qiagen, Duesseldorf, Germany) and transfected into cells using Lipofectamine 3000 (Life Technologies). For lentivirus construction, the precursor sequence of the YY1 CDS was inserted into the pLVX‐IRES‐ZsGreen vector and then co‐transfected with VSVG and PAX2 plasmids into HEK293 cells to produce lentivirus overexpressing YY1.
7
Lentiviral Vector Production Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Briefly, an approximately 1650 bp fragment containing the human EBF3 gene was directly cloned into the pMD18-T vector. Positive clones were confirmed by sequencing and subcloned into the pLVX-IRES-ZsGreen vector (Clontech Laboratories, Inc. Tokyo, Japan). The vector plasmids, pLVX-IRES-ZsGreen1, pLP1, pLP2 and pLP/VSVG were amplified in E.Coli and purified using the Endofree Maxiprep Kit (QIAGEN, Inc. Duesseldorf, German). 270 μg of transfer vector, 176 μg of pLP1, 95 μg of pLP/VSVG and 68 μg of pLP2 was mixed with 0.25 M CaCl2 (Sigma-Aldrich, St Louis, MO, USA) and added to same volume of 2 × HEPES (Sigma-Aldrich, St Louis, MO, USA) and mixed while bubbling for 20 min to allow a precipitate to form. This was then added to a 175 cm2 flask of approximately 60% confluent 293 T cells containing 20 mL DMEM supplemented with 10% fetal calf serum, 100 U/mL penicillin, 100 μg/mL streptomycin and 2 mM glutamine and incubated for 48 h at 37°C in 5% CO2. The supernatant was centrifuged at 1,700 g for 10 min to pellet cell debris, and ultracentrifuged at 121,603 g for 2 h. The pellet containing concentrated virus was resuspended in DMEM without supplements and stored at −80°C.
8
Cloning and Expression of KDM6A and KDM6B
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The complete KDM6A cDNA (NM_021140.4) was PCR-amplified, from a retrotranscribed human RNA pool (Agilent Technologies, Santa Clara, CA, USA) using Phusion High-Fidelity DNA Polymerase (Thermo Scientific, Waltham, MA, USA) following standard protocols. The cDNA fragments were cloned into the pLVX-IRES-ZSGreen vector (Clontech), between the XhoI and NotI endonuclease restriction sites, following the manufacturer’s instructions. For the KDM6B, the complete KDM6B coding region (ENSG00000132510.10) was PCR-amplified, from a human DNA pool (Agilent Technologies, Santa Clara, CA, USA) using Phusion High-Fidelity DNA Polymerase (Thermo Scientific, Waltham, MA, USA), following standard protocols. The fragment was cloned into the pCDNA4/TO vector (Invitrogen), between the KpnI and XhoI endonuclease restriction sites, following the manufacturer’s instructions. The KDM6A and KDM6B inserts were then Sanger-sequenced. All the primers used are listed in Supplementary Tables 4 and 5 . For KDM6A ectopic expression, the cells were infected with lentiviruses derived from the pLVX-IRES-ZSGreen vector and then selected by sorting GFP positive cells, using an BD FACSArea (Becton, Dickinson). For KDM6B ectopic expression, the cells of interest were transfected with a pCDNA4/TO-KDM6B construct and clones expressing KDM6B were selected with Zeocin (InvivoGen) and pooled.
9
Generating miR-101 and VHL-3'UTR Reporters
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HIFα over-expression vector was purchased from Addgene (Plasmid# 19365). To generate miR-101 expression vectors, a 420 bp fragment carrying pre-miR-101 was amplified from the MCF-7 genomic DNA by the high fidelity polymerase Phusion enzyme (New England Biolabs, Ipswich, MA) using PCR primers:
5′ tctagaTATTTCAGCCTCACCACTTGCT
5′ tctagaCCCCATGTTACAAAACAAGGCA.
The amplified fragment was cloned into the pLVX-IRES-ZsGreen vector (Clontech) at the Xba1 site.
To generate the luciferase reporter vector carrying the VHL-3′UTR region carrying the two putative binding sites of miR-101, we amplified a 2243 bp VHL-3′UTR region from the genome DNA of MCF-7 by the high fidelity polymerase Phusion enzyme (New England Biolabs, Ipswich, MA) using PCR primers:
5′ tctagaGGAGTAGCCTGGACTGTTTCAT
5′ tctagaTCCTTGGACAACACCAAAAACAC
The amplified fragment was cloned into the pGL3-control vector (Promega) at the Xba1 site.
To generate the VHL-3′UTR reporter vectors with mutated miR-101 binding sites, we used Phusion Site-Directed Mutagenesis Kit (Life Technologies) to directly mutate those two binding sites by using primers:
VHL-UTR-mut1f: p-catagttgagattCACACACtcatacagtttta
VHL-UTR-mut1r: p-taaaaaccaaccaaaatctgccctaaa
VHL-UTR-mut2f: p-acatgccgtttgaCACACACgtttttggtgttg
VHL-UTR-mut2r: p-tttttttttgtttttttggtttctttttg
VHL siRNA and anti-miR-101 oligos were purchased from Shanghai GenePharma.
5′ tctagaTATTTCAGCCTCACCACTTGCT
5′ tctagaCCCCATGTTACAAAACAAGGCA.
The amplified fragment was cloned into the pLVX-IRES-ZsGreen vector (Clontech) at the Xba1 site.
To generate the luciferase reporter vector carrying the VHL-3′UTR region carrying the two putative binding sites of miR-101, we amplified a 2243 bp VHL-3′UTR region from the genome DNA of MCF-7 by the high fidelity polymerase Phusion enzyme (New England Biolabs, Ipswich, MA) using PCR primers:
5′ tctagaGGAGTAGCCTGGACTGTTTCAT
5′ tctagaTCCTTGGACAACACCAAAAACAC
The amplified fragment was cloned into the pGL3-control vector (Promega) at the Xba1 site.
To generate the VHL-3′UTR reporter vectors with mutated miR-101 binding sites, we used Phusion Site-Directed Mutagenesis Kit (Life Technologies) to directly mutate those two binding sites by using primers:
VHL-UTR-mut1f: p-catagttgagattCACACACtcatacagtttta
VHL-UTR-mut1r: p-taaaaaccaaccaaaatctgccctaaa
VHL-UTR-mut2f: p-acatgccgtttgaCACACACgtttttggtgttg
VHL-UTR-mut2r: p-tttttttttgtttttttggtttctttttg
VHL siRNA and anti-miR-101 oligos were purchased from Shanghai GenePharma.
10
Engineered Peroxiredoxin I/II Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human Prx I and Prx II cDNAs were amplified from HEK293T cells by reverse transcription-PCR, and then cloned into pLVX-IRES-ZsGreen vector (PT4064-5, Clontech, Palo Alto, CA, USA) for generating Prx I and Prx II expression plasmids. SiRNA-resistant wide-type and cysteine-mutated Prx I/II (C173S and C172S) plasmids were generated by QuickChange Lightning Site-Directed Mutagenesis Kit (210518, Stratagen, La Jolla, CA, USA). The plasmids we made were further confirmed by DNA sequencing (Biosune, Shanghai, China). Transient transfection was performed with Hilymax transfection reagents according to the manufacturer's instructions (H357, Dojindo Molecular Technologies).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!