Steponeplus real time pcr system machine

CD45⁺ enrichment was performed using the Miltenyi Human CD45⁺ Enrichment Kit (cat #: 130-045-801). RNA from CD45⁺ enriched cell fractions was isolated using the commercially available Qiagen RNeasy mini kit and quantified using the NanoDrop. cDNA was generated using the High-Capacity RNA-to-cDNA Kit (Applied Biosystems catalog #4368814) according to manufacturer's protocol. 12.5 ng of cDNA was loaded per reaction onto a TaqMan Array 96 – Well FAST Plate (Applied Biosystems), as well as TaqMan probes [CSF-1R: ThermoFisher Scientific Hs00911250_m1, MSR1: ThermoFisher Scientific Hs00234007_m1, CX3CR1: ThermoFisher Hs01922583_s1. All plates were run on a StepOnePlus Real-Time PCR System machine (Applied Biosystems). Fold Expression was calculated as log₂^^-ΔΔCT.

RNA samples were retrotranscribed into cDNA using a Maxima H Minus First Strand cDNA synthesis kit (Thermo Scientific) with oligo(dT), according to the manufacturer's instructions. To detect Dg (a defective genome in SINV-G), PCR was performed using Phusion polymerase (Thermo Scientific) and the primer pair 414F (5′-AAGGATCTCCGGACCGTACT-3′) and 11634R (5′-ATTATGCACCACGCTTCCTCAGA-3′). To obtain the sequence of the Dg, the band was gel extracted using a QIAquick gel extraction kit (Qiagen) and then submitted to a second PCR with the same primers. Sequences were obtained from GATC Biotech. For quantitative PCR (qPCR), cDNA was mixed with power SYBR green PCR master mix (Applied Biosystems) and the following primer pairs: 4357F (5′-AAAACGCCTACCATGCAGTG-3′) and 4454R (5′-TTTTCCGGCTGCGTAAATGC-3′) for full-length genomes, 1634F (5′-TGCGAAGTGGAGGGGCTCC-3′) and 10565R (5′-TGAAATTGGTCCAGCTATGACTTT-3′) for Dg, and 1725F (5′-GCAAATGACCGTATGATCGGA-3′) and 11297R (5′-AAACAGCCAACTCCATGATG-3′) for Dwt (a defective genome in SINV-WT). A StepOne Plus real-time PCR system machine (Applied Biosystems) was used according to the manufacturer's instructions.

Complementary DNA for the quantification of mRNA was generated using the high capacity RNA-cDNA kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions. Total RNA isolated from cells (1 µg) was used to generate cDNA. The cDNA was subjected to qPCR. The mRNA levels of fatty acid synthase (FAS1) were measured using qRT-PCR with Fast SYBR Green master mix (Applied Biosystems) using a StepOne Plus Real-Time PCR System machine (Applied Biosystems). Primers: twist For: 5′-GGAGTCCGCAGTCTTACGAG-3′ Rev: 5′-TCTGGAGGACCTGGTAGAGG-3′, β-actin For: 5′-AGAAAATCTGGCACCACACC-3′ Rev: 5′-AGAGGCGTACAGGGATAGC-3′, GAPDH For: 5′-GATCATCAGCAATGCCTCCT 3′; Rev: 5′ TGTGGTCATGAGTCCTTCCA 3′. The PCR steps were 1 cycle at 95 °C for 5 min, 40 cycles of 95 °C for 5 s, and 60 °C for 30 s. The 2^(-ΔΔCT) method was used to determine the relative amounts of mRNA.

After relevant experimentation, RNA was extracted from cells using miRNeasy Mini Kit (Qiagen 217084). RNA was quantified using the Invitrogen Qubit RNA BR Assay Kit (Invitrogen Q10210). RNA was then converted to cDNA using the Applied Biosystems High-Capacity cDNA Kit (TaqMan MultiScribe). After reverse transcription, 100ng of DNA was combined with Applied Biosystems TaqMan Universal PCR Master Mix plus respective Taqman probes (see S3 Table in S1 File) and run in triplicate in an Applied Biosystems StepOnePlus Real-Time PCR System machine.