The largest database of trusted experimental protocols

Mir 484 mimic

Manufactured by Thermo Fisher Scientific

The MiR-484 mimic is a synthetic RNA molecule designed to mimic the function of the naturally occurring microRNA-484 (miR-484). MiR-484 is involved in the regulation of gene expression, but its core function is not to be interpreted or extrapolated upon in this description.

Automatically generated - may contain errors

2 protocols using mir 484 mimic

1

Luciferase Reporter Assay for miRNA Target Validation

Check if the same lab product or an alternative is used in the 5 most similar protocols
TCTTAAACATTGTTTTGTAGTGTATATTACTTGTCCATTCCTTTAAGGGGAGCTTTAAACACTCTTTTGTAGATTACTTTTGGGGGATATATTTTGAGAATGATGAAACGGAATAAAATTGTAAAAAATTAATTGTAGTTTTAA.
Seventy-thousand cells were seeded in 24-well plates and co-transfected with 100 nM of mirVana miRNA mimic, negative control #1 (Cat# 4464058), or miR-484 mimic (Cat# 4464066, Assay ID MC10379) from Thermo, 100 ng of luciferase reporter pLenti-UTR-Luc PSMG1 WT or pLenti-UTR-Luc PSMG1 MUT, and 4 ng of pRL-CMV Renilla luciferase reporter (Cat# E2261) from Promega (Madison, WI), using TransIT-X2 (Cat# 6004) from Mirus (Madison, WI). Cells were cultured for another 48 h and washed once in PBS. Using a Luc-Pair Duo-Luciferase HS Assay Kit (Cat# LF004) from GeneCopoeia (Rockville, MD), cells were then lysed, loaded onto white 96-wells in quadruplicates, and their luciferase/Renilla ratios were measured using a FLUOstar Omega microplate reader from BMG Labtech. The experiment was repeated for n = 4.
+ Open protocol
+ Expand
2

PSMG1 Expression in DU145 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
DU145 cells were transfected with 30 nM of mirVana miRNA mimic, negative control #1 (Cat# 4464058), or miR-484 mimic (Cat# 4464066, Assay ID MC10379) from Thermo (Waltham, MA). Forty-eight hours after transfection, total protein was extracted from cells using RIPA buffer (Cat# 89901) with Halt Protease Inhibitor Cocktail (Cat# 87786), and 50 μg of protein was loaded on a 16% Tris-Glycine gel (XP00165BOX) from Thermo followed by immunoblotting. Primary antibodies used were PSMG1 (1:1000 of Cat# 13378) from Cell Signaling (Danvers, MA) and β-Actin (1:5000 of sc-47778) from Santa Cruz (Dallas, TX). The secondary antibody for the PSMG1 Western was an ECL anti-Rabbit IgG, HRP-linked F(ab')2, fragment (from donkey) (#NA9340V) from GE Healthcare (Marlborough, MA), used at a 1:5000 dilution. Visualization of β-Actin using the labeled primary antibody from Santa Cruz does not require a secondary antibody. Chemiluminescent signal was captured on the Bio-Rad ChemiDoc Imaging System. The experiment was repeated for n = 3.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!