Tb green advantage qpcr premixes

The DNA was isolated using QIAamp DNA Mini Kit (Cat#51304, QIAGEN GmbH, Hilden, Germany) according to the manufacturer’s protocol. The Real-Time PCR (qPCR) amplification was performed using a Rotor-Gene Q (QIAGEN) thermal cycler using TB Green Advantage qPCR Premixes (Takara Bio, Mountain View, CA, USA) and primers (UL54F–5′ CGCCAAGAAAATTTCATCGAG 3′, UL54R–5′ ACATCTTGCACCACGCCAG 3′) for the UL54 coding region (encoding ICP27—A regulatory protein required for HHV-1 infection). These were the amplification parameters: initial denaturation (95 °C, 20 s); cycling (45 repeats: denaturation (95 °C, 5 s); annealing/extension (60 °C, 30 s); fluorescence acquisition (Green); melting curve analysis (60–95 °C). The viral load was measured with reference to the calibration curve. The calibration curve comprised of tenfold dilutions of stock virus DNA isolate quantitatively analysed using IVD certified GeneProof Herpes Simplex Virus (HSV-1/2) PCR Kit (Cat#HSV/ISEX/025, GeneProof a.s., Brno, Czech Republic), following the manufacturer’s procedure.

TRIzol Reagent (Fisher Scientific, 15596018) was used to lysis U937 cells for isolating total RNA, and PrimeScript RT reagent kit with gDNA Eraser (TaKaRa, RR047A) was used to synthesize cDNA. TB Green Advantage qPCR premixes (TaKaRa, 639676) was used for qPCR reaction on an ABI Prism 7500 Sequence Detection system (Applied Biosystems). The sequences of primers were listed as following: GAPDH forward-GATTCCACCCATGGCAAAT; GAPDH reverse-GACAAGCTTCCCGTTCTCAG; RHOU forward-GCTACCCCACCGAGTACATC; RHOU reverseGGCTCACGACACTGAAGCA; SPI1 forward-GTGCCCTATGACACGGATCTA; SPI1 reverse-AGTCCCAGTAATGGTCGCTAT. The expression levels of the genes were normalized against the internal control GAPDH.

The DNA isolation was carried out using a commercially available kit (QIAamp DNA Mini Kit, QIAGEN GmbH, Hilden, Germany) following the manufacturer’s instructions. The real-time PCR amplification was performed using TB Green Advantage qPCR Premixes (Takara Bio, Mountain View, CA, USA) and primers (UL54F—5′ CGCCAAGAAAATTTCATCGAG 3′, UL54R—5′ ACATCTTGCACCACGCCAG 3′) on the Rotor-Gene Q (QIAGEN) thermal cycler. The amplification cycle parameters were as follows: initial denaturation (95 °C, 20 s); cycling (45 repeats: denaturation (95 °C, 5 s), annealing/synthesis (60 °C, 30 s), fluorescence acquisition (Green); melting curve analysis (60–95 °C). The quantitative analysis was carried out using a calibration curve comprised of tenfold dilutions of HSV-1 DNA isolate, which were previously quantitatively analyzed using the IVD certified GeneProof Herpes Simplex Virus (HSV-1/2) PCR Kit (GeneProof a.s., Czech Republic).