Plv h1 ef1α puro

shRNA targeting human CCL16 and a scrambled control sequence are listed in Table S1. Palindromic DNA oligos were annealed to form a double-stranded oligo and ligated to the linearized pLV-H1-EF1α-puro (Biosettia, cat. # B19) vector to generate circled pLV-H1-shCCL16-Puro. To construct the human CCL16 overexpression plasmid, the cDNA of CCL16 was cloned using the primer pairs listed in Table S1. The amplified fragments were finally ligated into pLV-EF1α-MCS-IRES-Puro (Biosettia, cat. # pLV-03) expression vector to generate pLV-EF1α-CCL16-Puro.

The human cDNA fragment encoding full-length ZEB1 and Ngn3 was prepared by PCR and cloned into pLV-EF1-MCS-IRES-Bsd (Biosettia, San Diego, USA). The lentiviral-based vector pLV-H1-EF1α-puro (Biosettia, San Diego, USA) was used to express shRNAs in breast cancer cells. The human Ngn3 full-length and truncated promoter sequences were obtained by PCR from human genomic DNA and cloned into the pGL3-basic vector (Promega, Wisconsin, USA). Primer sequences are listed in Supplementary Data.

The coding sequence of HTR1E was synthesized by Sangon Biotech (Shanghai, China) and cloned into plasmid pLV-EF1α-MCS-IRES-Bsd (Biosettia, San Diego, CA, USA). Stable HTR1E overexpressing was conducted in OVCAR-5 cell line. Lentivirus-based RNAi vector pLV-H1-EF1α-puro (Biosettia) with the insertion of shRNA templates were used to conduct HTR1E knocking down in SK-OV-3 cell line. Cells infected with lentivirus for knocking down or reconstituted expression were selected with 4 μg/mL of blasticidin or 10 μg/mL of puromycin (Thermo-Fisher Scientific, Waltham, MA, USA) for one week. The sequences of the shRNA used were as follow: shHTR1E-#1, 5' AAAAGCATGGCTATAAGACCCAAGATTGGATCCA 3'; shHTR1E-#2, 5' AAAAGCCAACTACCTAATCTGTTCTTTGGATCCA 3'; shCtrl, 5' AAAAGCAGTTATCTGGAAGATCAGGTTGGATC 3'.

Acebutolol, alprenolol, atenolol, bucindolol, carazolol, carvedilol, CGP12177, ICI 118551, isoproterenol, labetalol, metoprolol, nadolol, nebivolol, pronethalol, timolol, and 2-{[β-(4-Hydroxyphenyl)ethyl]aminomethyl}-1-tetralone hydrochloride (HEAT HCl) were purchased from Tocris (Bristol, United Kindom). Propranolol HCl and 4-hydroxycarbazole were obtained from Sigma-Aldrich (St. Louis, MO) and bupranolol was obtained from Abcam (Cambridge, UK). All compounds were dissolved in DMSO to obtain a 10 mM stock concentration, which was stored at -20°C. EGF was purchased from Peprotech (Rocky Hill, NJ) and dissolved in sterile deionized water at a 10 ug/mL stock and stored at -80°C. Primers were purchased from IDT (Coralville, IA). The lentiviral vector pLV-H1-EF1α-puro, annealing buffer, packaging vector, and polybrene were purchased from Biosettia Inc. (San Diego, CA). 4-hydroxycarbazole (4-OHC) was purchased from Sigma Aldrich

ZR-75-1, BT-474, T-47D, MDA-MB-231, MDA-MB-453, MDA-MB-436, MDA-MB-435 and HCC1937 cells were obtained from the Cell Bank of Chinese Academy of Sciences (Shanghai, China). MCF7, 4T1, 4TO7 and EO771 cells were obtained from Dr. Ralph A. Reisfeld (The Scripps Research Institute, CA, USA). EMT6 was obtained from the Laboratory Animal Research Center of the Fourth Military Medical University (Xi’an, Shanxi, China).
shRNAs with the following sequences in Supplementary Table 1 were utilized. The targeting shRNAs were cloned into the pLv-H1-EF1α-puro or pLv-H1-EF1α-Bsd plasmid (Biosettia Inc., San Diego, CA, USA). Lentivirus infections were performed following the manufactures’ instructions. Stable polyclonal cell lines were selected by adding puromycin or blasticidin to the cell culture medium.

The human complementary DNA (cDNA) fragment encoding the full-length Zeb1 sequence^{51 (link)} was prepared by PCR and cloned into pLV-EF1-MCS-IRES-Bsd (Biosettia). The lentiviral-based vector pLV-H1-EF1α-puro (Biosettia) was used to express shRNAs in breast cancer cells and HUVECs. The human ZEB1 promoter (−1915/+132) sequences were obtained by PCR from human genomic DNA and cloned into the pGL3-basic vector (Promega). Mutagenesis of NRE-I and NRE-II in the human Zeb1 promoter was performed using a QuikChange^® Lightning Site-Directed Mutagenesis kit (Stratagene). Primer sequences are listed in Supplementary Table 3.