To confirm each SARS-CoV-2 mutation, NGS was performed for whole-genome analysis. NGS was performed by the Illumina NovaSeq 6000 or Illumina MiSeq method (Illumina, San Diego, CA), which produced 150-base pair-end reads per sample. The isolated viral RNA was subjected to whole-genome sequencing. Nine clinical samples and 23 viral-particle–containing cell culture supernatants were used for the whole-genome analysis. NGS libraries were prepared by means of the data obtained from the sequences, and the analysis was performed via barcode-tagged sequencing technology (Celemics Inc., Seoul, Korea). Multiple-sequence comparison by log-expectation was conducted to perform the multiple-sequence alignment of SARS-CoV-2 genomes. Phylogenetic tree was constructed by the maximum likelihood (M-L) method16 (link) using Molecular Evolutionary Genetics Analysis across Computing Platforms (MEGA X) software17 (link). One thousand bootstrap replicates were utilized to evaluate replicated-tree confidence.
Miseq method
Manufactured by Illumina
The MiSeq is a benchtop DNA sequencing system designed for small-scale next-generation sequencing applications. It utilizes Illumina's proprietary sequencing-by-synthesis technology to perform high-throughput, accurate DNA sequencing. The MiSeq system is capable of generating high-quality sequencing data with a rapid turnaround time.
Automatically generated - may contain errors
Lab products found in correlation
Miseq reagent kit and instrument, by Illumina (2 mentions)
Nextflex series, by Illumina (2 mentions)
Onetaq hot start master mix, by New England Biolabs (2 mentions)
Pcr purification kit, by Qiagen (2 mentions)
Phix control, by Illumina (2 mentions)
Novaseq 6000, by Illumina (1 mentions)
Powersoil kit, by Qiagen (1 mentions)
8 protocols using miseq method
1
SARS-CoV-2 Genome Sequencing Protocol
2
Illumina-based deep sequencing of XNA selections
3
Rhesus Macaque MHC Class I Typing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The MHC class I genes of a cohort of 15 rhesus macaques (Envigo, Alice, TX, USA) were molecularly typed by the University of Wisconsin–Madison National Primate Research Center. Mamu (Macaca mulatta) MHC class I alleles were typed amplifying the genomic DNA of each subject using a panel of specific primers for exon 2 of all known MHC-A and MHC-B alleles encoded by each subject’s target DNA. Resulting amplicons were sequenced by the Illumina MiSeq method [32 (link)]. The primer panel contained specific primer pairs able to amplify all possible MHC-A and MHC-B alleles encoded by each macaque. Sequencing data analysis provided a high-resolution haplotype for the MHC-A and MHC-B alleles carried by each subject. Following analysis, we selected four of the 15 macaques for vaccination based on peptide MHC binding predictions as described below.
4
Illumina-based deep sequencing of XNA selections
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Amplified polyclonal cDNA from XNA selections was prepared for deep sequencing by the Illumina Miseq method by appending the bridge-amplification sequences by PCR. Sequencing library generating PCR reactions were performed with OneTaq Hot Start master mix (NEB, USA) with 10 ng/50ul gel-purified polyclonal template DNA (see above), 0.1 μM primers (P5_P2 and P3_Test7-2) and cycling conditions 94°C for 1 min, 10×[94°C for 30 sec, 56°C for 30 sec, 72°C for 30 sec], 72°C for 2 min. Sequencing library DNA was purified using a PCR purification kit (Qiagen, Netherlands), then a 12pM sample of pooled libraries plus 20% PhiX control (Illumina, UK) was denatured and sequenced (single-end read, 75 cycles) using a MiSeq reagent kit and instrument (Illumina, UK) according to manufacturer’s instructions. Libraries were barcoded using variants of the P5_P2 primer containing 6nt sequences from the NEXTflex series (Illumina, UK). Data was analysed using the Galaxy server33 (link)-35 (link) and sequences ordered by abundance.
5
Microbial Community Analysis via 16S rDNA Sequencing
6
Fungal Community Analysis via Illumina Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to fully understand the community structure of fungal sample and analyse fungus microbial diversity, while excluding errors that human operation brings, genome sequencing method in fields of molecular biology was employed in this study to obtain micro biological information. Illumina Company developed Miseq method with higher flux and simple operation and lower cost for genome sequencing. Besides, the synthesis of side edge sequencing method with higher reliability is more suitable for laboratory community structure. The high-throughput sequencing was found to be useful to characterize compositions and diversities of moulds. The gene sequence of the test samples from genome sequencing was dealed with, such as stitching and matching, and the sample had a total of 59309 high quality fungal sequences, with an average length of 219 bp. The optimized sequence and the average length of the sample are shown in Table 2 .
7
Bacterial Lactase Gene Diversity via PCR and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As in our previous report [18 ], bacterial lactase genes were PCR-amplified with our universal primers. The PCR mixture (25 μL volume) was composed of 5 μL 5×reaction buffer, 5 μL 5×high GC buffer, 0.5 μL 10 mmol/L dNTPs, 0.25 μL Q5 high-fidelity DNA polymerase, 1 μL 10 μmol/L each forward primer and reverse primer, 1 μL extracted DNA, and 11.25 μL sterilized ddH2O. The PCR was performed with initial denaturation at 98°C for 30 s, followed by denaturation at 98°C for 15 s, annealing at 46°C for 30 s, and extension at 72°C for 30 s, for a total of 32 cycles, a final extension cycle at 72°C for 5 min, and holding at 4°C. All the PCR products were determined by 2% agarose electrophoresis. Then, PCR products were sequenced by using the Illumina MiSeq method for bacterial lactase gene diversity. The sequencing service was provided by Personal Biotechnology Company (Shanghai).
8
Microbial Diversity Analysis via DNA Extraction and PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The extraction of total DNA was carried out using a commercial kit (PowerSoil kit QIAGEN) on frozen samples. For fungal diversity, extractions were amplified by PCR using the primer pair fITS7-ITS4. Each PCR was done at three different temperatures (48, 51 (link), and 58 • C) to allow the primers to combine with as many species as possible (see [28] (link)). For bacterial diversity, the same DNA extractions were amplified by PCR at a single temperature of 48 • C with the 16S specific 515F-805R primer pair with a CS1 (ACACTGACGACATGGTTCTACAGTGCCA GCMGCCGCGG) and CS2 (TACGGTAGCAGAGACTTGGTCTGACTACHVGGGTATCTAATCC) tag added at the final 5' extremities [39] (link). PCR were performed using the same master mix preparation as Laperriere et al. (2019) [28] (link). PCR reaction was made with the following thermocycling conditions: 34 cycles of 30 s at 94 • C, 30 s at 48 • C, and 40 s at 72 • C. Reactions were preceded by a 3 min denaturation step at 94 • C and terminated with a 5 min elongation step at 72 • C. In all cases, all amplicons were verified on agarose gel before analysis and sent to for sequencing with the Illumina MiSeq method to GenomeQuébec Innovation Center of McGill University.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!