Sybrs green pcr master mix

Cell lines and tissues from 79 human glioma patients and 18 normal brain samples were applied for total RNA extraction using the Trizol reagent (Invitrogen) according to the manufacturer’s instructions. Reverse transcription of total RNA was conducted using HiScript II Q RT SuperMix for qPCR (Vazyme, Nanjing, China). Quantitative real-time PCR (qRT-PCR) was performed using SYBRs Green PCR Master Mix (Vazyme) on Roche instruments (Applied Biosystems). The primers used for qRT-PCR amplification of human S100A11 gene were AGGAGAGGCTCCAGACCCG and ACCGCTCAGTCTCTGTAGGG, with a PCR product of 228 bp. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the endogenous control, and its primer was AGGTCGGTGTGAACGGATTTG and TGTAGACCATGTAGTTGAGGTCA. The 2^-ΔΔCt method was used as a relative quantification measure for calculatinf the differential expressions.^{17 (link)} The program was as follows: an initial denaturation step at 95 ^oC for 5 minutes, followed by 40 cycles of denaturation at 60 ^oC for 15 seconds. A melting curve analysis of each sample was used to check the specificity of amplification, and each sample was assayed in triplicate.

Cellular RNA was extracted using the Trizol reagent (Invitrogen, USA), and exosomal RNA was extracted using the Exosome RNA Purification Kit (Simgen, China). circRNA inverse transcription was carried out using HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (R312-01, Vazyme, China). miRNA inverse transcription was carried out using a miRNA 1st Strand cDNA Synthesis Kit (MR101-01, Vazyme, China). Total RNA inverse transcription was conducted using HiScript II QRT SuperMix for qPCR (R222-01, Vazyme, China). qRT-PCR was performed using SYBRs Green PCR Master Mix (Q131-02, Vazyme, China) on Roche instruments (Applied Biosystems). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the endogenous control. U6 snRNA was used as negative control for miRNA. The 2^−ΔΔCt method was used as relative quantification measure of differential expression.24 (link) The specific primers used for these analyses are listed in Supplementary Table 1.