Log In Sign up
The largest database of trusted experimental protocols

Dsred rab11

Manufactured by Addgene
Visit Supplier

DsRed-Rab11 is a fluorescent protein fusion construct that combines the DsRed red fluorescent protein with the Rab11 protein. Rab11 is a small GTPase that regulates membrane trafficking and recycling processes within the cell. The DsRed-Rab11 fusion protein can be used to visualize the localization and dynamics of Rab11-positive vesicles and recycling endosomes in live cells.

Automatically generated - may contain errors

Lab products found in correlation

Pcmv cat t7 sb100, by Addgene (1 mentions) Lamp1 rfp, by Addgene (1 mentions) Dsred rab7, by Addgene (1 mentions) Mrfp lc3, by Addgene (1 mentions) Psbbi gp, by Addgene (1 mentions) Mcherry atg5, by Addgene (1 mentions) Tf lc3, by Addgene (1 mentions) Gfp rab7, by Addgene (1 mentions) Pegfp n1, by Addgene (1 mentions) Egfp lc3, by Addgene (1 mentions) Mrfp rab7, by Addgene (1 mentions) Gene pulser 2, by Bio-Rad (1 mentions) Mcherry rab5, by Addgene (1 mentions) Mcherry hlc3b pcdna3, by Addgene (1 mentions) Rab7 mcherry, by Addgene (1 mentions)

3 protocols using dsred rab11

1

CRISPR/Cas9 Editing of TRAC Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following expression plasmids were obtained from Addgene: tf-LC3, EGFP-LC3 (#11546), mRFP-LC3 (#21075), GFP-Rab5B (#61802), EGFP-Rab6A (#49469), GFP-Rab7 (#12605), dsRed-Rab7 (#12661), dsRed-Rab11 (12679), LAMP1-RFP (#1817), mCherry-LAMP1 (#45147), mCherry-Atg5 (#13095), mCherry-p62(#55132), EGFP-Vamp7 (#42316), pEGFP-N1, and plasmids for the Sleeping Beauty transposon system, pCMV(CAT)T7-SB100 (#34879) and pSBbiGP (#60511). Plasmids for CRISPR/Cas9-mediated editing of TRAC, including pAP368 (to express TRAC gRNA-1 and EGFP reporter gene), pAP369 (to express TRAC gRNA-2 and EGFP reporter gene), and pAP370 (to express SpCas9) were obtained from Dr. Charles Gersbach’s laboratory. sgRNAs targeting TRAC were purchased from IDT; the sgRNA sequences were: AGAGTCTCTCAGCTGGTACA (sgRNA-1) and TGTGCTAGACATGAGGTCTA (sgRNA-2). PCR primers used in sequencing TRAC were TTGCTGGGGTTTTGAAGAAG (forward) and GGTTTTGGTGGCAATGGATA (reverse).
Mao M., Chang C.C., Pickar-Oliver A., Cervia L.D., Wang L., Ji J., Liton P.B., Gersbach C.A, & Yuan F. (2020). Redirecting Vesicular Transport to Improve Non-viral Delivery of Molecular Cargo. Advanced biosystems, 4(8), e2000059.
+ Open protocol
+ Expand
2

Live Cell Imaging of APOL1 and Rab Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
Live cell imaging were performed as described previously48. Briefly, GFP-APOL1, or GFP-APOL1 D388, and mRFP-Rab7 (Addgene), or DsRed-Rab11 (Addgene) tagged proteins were coexpressed in Cos7 cells by electroporation (Gene Pulser II (Bio-Rad)). Transfected cells were seeded in glass-bottomed 35-mm dishes (no. 1.5 thickness; MatTek) and imaged 18 h later. Before imaging, medium was replaced with an imaging buffer (containing 136 mM NaCl, 2.5 mM KCl, 2 mM CaCl2, 1.3 mM MgCl2, and 10 mM HEPES [pH 7.4]). Cells were imaged using an Andor spinning confocal microscope with ×60 oil immersion objectives.
Beckerman P., Bi-Karchin J., Park A.S., Qiu C., Dummer P.D., Soomro I., Boustany-Kari C.M., Pullen S.S., Miner J.H., Hu C.A., Rohacs T., Inoue K., Ishibe S., Saleem M.A., Palmer M.B., Cuervo A.M., Kopp J.B, & Susztak K. (2017). Transgenic Expression of Human APOL1 Risk Variants in Podocytes Induces Kidney Disease in Mice. Nature medicine, 23(4), 429-438.
+ Open protocol
+ Expand
3

Generating Fluorescent-Tagged RAB Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
Vectors expressing tagged-RAB proteins were purchased from Addgene: RFP-RAB4 (79,800; deposited by J.D. Johnson); DsRed-RAB11 (12,679; deposited by R. Pagano); mCherry-RAB7 (61,804; deposited by G. Voeltz); mCherry-RAB5 (49,201; deposited by G. Voeltz); DsRed-RAB9 (12,677; deposited by R. Pagano); mCherry-hLC3B-pcDNA3.1 (40,827; deposited by D. Rubinszstein). The following vectors were kindly provided by colleagues: EGFP-WIPI1 (pAR31CD vector) and EGFP-WIPI1[FAAG] (Tassula Proikas-Cezanne, Tübingen, Germany); pEGFP-FYVE2 (Harald Stenmark, Department of Molecular Cell Biology, Institute for Cancer Research, Oslo, Norway); mCherry-ML1N2 (Haoxing Xu, University of Michigan, Ann Arbor, USA).
To generate mCherry-WIPI1, mCherry and WIPI1 fragments were amplified from pFA6a-mCherry-V5-KanMX6 (from Fulvio Reggiori, University Medical Center Groningen, Netherlands) and EGFP-WIPI1 plasmid, respectively, by using the primers listed in Table S1. Then, the two fragments were fused by using overlap extension-PCR and cloned into the pAR31CD vector between Age1 and EcoR1 restriction sites.
To obtain EGFP-WIPI1[15Gly-CVVM] a sequence with 15 glycine and a CVVM motif were added to EGFP-WIPI1 plasmid by PCR using the primers listed in Table S1. The product was sub cloned into the pAR31CD-WIPI1 vector between Xmn1 and EcoR1 restriction sites.
De Leo M.G., Berger P, & Mayer A. (2021). WIPI1 promotes fission of endosomal transport carriers and formation of autophagosomes through distinct mechanisms. Autophagy, 17(11), 3644-3670.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!