Total RNAs of rapeseed embryo, maize embryo, and castor bean endosperm were extracted for transcriptome analyses. Plant tissues were grounded with liquid nitrogen and total RNAs were isolated following manufacturer’s instructions of the RNA extraction kit (9769, TaKaRa). RNA concentration was measured using nanodrop spectrophotometer (Nanodrop Technologies, Santa Clara, CA, USA) and integrity was evaluated with the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). Subsequently, an Illumina TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA) was used to build cDNA libraries.
Rna extraction kit
Manufactured by Takara Bio
Sourced in Japan, China, United States
The RNA extraction kit is a laboratory tool designed to isolate and purify ribonucleic acid (RNA) from various biological samples. It utilizes a specialized protocol and reagents to effectively extract and concentrate RNA molecules, which are essential for various scientific applications.
Automatically generated - may contain errors
Lab products found in correlation
Primescript rt reagent kit, by Takara Bio (41 mentions)
Reverse transcription kit, by Takara Bio (29 mentions)
Primescript rt master mix, by Takara Bio (24 mentions)
Sybr premix ex taq, by Takara Bio (21 mentions)
Sybr premix ex taq 2, by Takara Bio (18 mentions)
Cdna synthesis kit, by Takara Bio (14 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (13 mentions)
Sybr premix ex taq kit, by Takara Bio (12 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (10 mentions)
Trizol reagent, by Thermo Fisher Scientific (8 mentions)
Nanodrop, by Thermo Fisher Scientific (8 mentions)
Nanodrop 2000c, by Thermo Fisher Scientific (8 mentions)
Tb green premix ex taq, by Takara Bio (7 mentions)
Sybr premix ex taqtm, by Takara Bio (6 mentions)
Primescript rt master mix kit, by Takara Bio (6 mentions)
Tb green premix ex taq 2, by Takara Bio (6 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (6 mentions)
Reverse transcription kit, by Thermo Fisher Scientific (6 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (5 mentions)
Chamq universal sybr qpcr master mix, by Vazyme (5 mentions)
351 protocols using rna extraction kit
1
Transcriptome Analysis of Plant Tissues
2
Glucose Metabolism in UCB-MSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
UCB-MSCs were treated with cP1P or vehicle, after which the cells were washed twice with PBS twice and lysed with buffer-RL-added 50X DTT solution. The total RNA was extracted using an RNA extraction kit (Takara, Tokyo, Japan, #9767), according to the manufacturer’s instructions. Reverse-transcription PCR (RT-PCR) was conducted with 1 μg of total RNA with a Maxime RT premix kit (iNtRON, Sungnam, Korea, #25081). The cDNA was amplified using a Maxime PCR PreMix Kit (iNtRON, #25165) with a MyGenie 96 (Bioneer, Daejeon, Korea). The relative mRNA expression level of the target gene was analyzed using a Rotor-Gene 6000 device (Corbett Research, Cambridge, UK) with the TB Green Premix Ex Taq (TaKaRa, #RR420A). The specificity, efficiency, and fidelity of PCR primers for real-time quantitative PCR were validated by checking PCR products and melting curve analysis. Primer sequences are listed in Supplementary Table S1 . The relative mRNA expression levels of the SLC2A1, LDHA, PDK1, and NHE1 were analyzed using the delta-delta Ct method. The 18 S rRNA gene was used as the normalization reference gene.
3
Molecular Cloning of Rhizoctonia Effectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rhizoctonia solani total RNA extraction was based on the manufacturer’s instructions of RNA extraction kit (TaKaRa). Complementary DNA synthetization was performed by using PrimeScriptTM 1st Strand cDNA Synthesis Kit (TaKaRa). Phanta Max Super-Fidelity DNA Polymerase (Vazyme) was used for full-length and truncated putative effector-encoding genes amplification. PCR products were digested with XhoI and SpeI and subcloned into pTA7001 (Aoyama and Chua, 1997 (link)), which was constructed with 3 × HA. All constructs were confirmed with sequencing. Primers used in this study are listed in Supplementary Table S2 .
4
Quantification of Apoptosis-Related Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of above 50 μL supernatants was extracted from by using a RNA extraction kit (TaKaRa Biotechnology (Dalian) Co., Ltd., Dalian, China). Specific primers for Bcl-2, bax, and caspase-3 genes were designed and synthesized by TaKaRa (β-actin, forward primer: CACGATGGAGGGGCCGGACTCATC, reverse primer: TAAAGACCTCTATGCCAACACAGT; Bcl-2, forward primer: GGTGAACTGGGGGAGGATTG, reverse primer: GCATGCTGGGGCCATATAGT; bax, F: GGCGATGAACTGGACAACAA, R: CAAAGTAGAAAAGGGCAACC; and Caspase-3, forward primer: GGACCTGTGGACCTGAAAAA, reverse primer: GCATGCCATATCATCGTCAG). Reverse transcription was performed as follows: 42°C, 1 h; 95°C, 5 min. cDNA was used for a multiplex qRT-PCR by using real-time PCR system instrument (Thermo Fisher Scientific, Waltham, MA, USA) and SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA). RT-PCR reactions were performed under the following conditions: one cycle of 95°C for 5 min, followed by 45 cycles of 95°C for 10 s, 60°C for 15 s, and 72°C for 20 s. β-Actin was used as a control. Fold change was calculated as 2-ΔΔCt.
5
Autophagy Regulation in Cardiac Myocyte Injury
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All reagents in the study are as follows: QiShenYiQi pill (Tasly Pharmaceutical Co., Ltd., Tianjin, China); 3‐methyladenine (ApexBio, Houston, TX, USA); porcine cardiac myosin and complete freund's adjuvant (Sigma Aldrich, USA); haematoxylin and eosin staining kit, masson trichrome staining kit, RIPA lysate, phosphatase inhibitor and protease inhibitor (Leagene Biotechnology Co., Ltd., Beijing, China); BCA protein concentration test kit (Boster Biological Technology Co., Ltd., Wuhan, China); PI3K antibody, Akt antibody, mTOR antibody, LC3B antibody, Beclin‐1 antibody, p62 antibody, HRP‐conjugated Affinipure Goat Anti‐Mouse IgG, HRP‐conjugated Affinipure Goat Anti‐Rabbit IgG and ECL chemiluminescence detection kit (Proteintech Group, Inc, USA); p‐PI3K antibody (Abcam, Cambridge, UK); p‐akt antibody and p‐mTOR antibody (Cell Signaling Technology, Inc, USA); RNA extraction kit (Takara Biomedical Technology Co., Ltd., Beijing, China); TransScript First‐Strand cDNA Synthesis SuperMix (TransGen Biotech Co., Ltd., Beijing, China); PowerUp™ SYBR™ Green Master Mix (Thermo Fisher Scientific, Inc, USA).
6
Cajanol Modulates Multidrug Resistance Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Medium containing 2, 4 or 8 µM cajanol was prepared and incubated with A2780/Taxol cells to determine the effect of cajanol on ABCB1, MMP-9, VEGF, Tubα1a and Tubβ3 mRNA expression. After 48 h of co-incubation, total RNA was isolated using a RNA Extraction Kit (Takara Bio Inc., Dalian, China), and total RNA reverse transcription was performed using a Reverse Transcription Kit (Takara). Real-time quantitative PCR primers were designed using Primer Premier 5.0 (Supplementary Table S1 ), and SYBR® Premix Ex Taq™ II kit (Takara) was used for the RT-qPCR assay. β-actin was selected as the internal reference gene; the reaction conditions have been previously described (Huang et al., 2017 (link)). Relative gene expression was calculated by the 2−ΔΔ Ct method.
7
Quantitative PCR of Antioxidant Genes in Mouse Brain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After extraction with a commercial RNA Extraction Kit (Takara, Otsu, Shiga, Japan), 1 μg of RNA extracted from mouse brain tissues was reverse-transcribed to cDNA. qPCR was conducted on LightCycler 480 Instrument II (Roche, Indianapolis, IN, USA) with a Takara SYBR Premix Ex Taq Kit. The following are primer sequences used: SOD1, 5′-GTGATTGGGATTGCGCAGTA-3′ (forward) and 5′-TGGTTTGAGGGTAGCAGATGAGT-3′ (reverse); SOD2, 5′-TTAACGCGCAGATCATGCA-3′ (forward) and 5′-GGTGGCGTTGAGATTGTTCA-3′ (reverse); γ-glutamate-cysteine ligase catalytic subunit (GCLC), 5′-AGCACAGGGTGACAGAAGAG-3′ (forward) and 5′-GAGGGACTCTGGTCTTTGTG-3′ (reverse); and GAPDH, 5′-AACGACCCCTTCATTGAC-3′ (forward) and 5′-TCCACGACATACTCAGCAC-3′ (reverse). Target gene expression was evaluated with the 2-ΔΔct method.
8
Gene Expression Analysis of Osteoblastogenesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
1 × 105 cells/well were seeded in 6-well plates. Total RNA was extracted by the use of a RNA Extraction Kit (TAKARA, Japan). The concentration and purity of extracted RNA were evaluated by NanoDrop (Thermo Scientific, USA). After cDNA was synthesized, real-time quantitative PCR was conducted using SYBR® Premix Ex Taq™ II (TAKARA, Japan) on an ABI QuantStudio 3 PCR System (Applied Biosystems, USA). The primer sequences for HMGB1, RAGE, heme oxygenase-1, Runx2, ALP, OCN, OPG, RANKL, and β-actin are listed in Table 1 . The expressions of detected genes were figured out by 2−∆∆CT method.
9
Chromium Citrate Synthesis and Evaluation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromium citrate was synthesized in our laboratory.[19 (link)] Insulin (PubChem CID: 16131099) and dimethyl sulfoxide (DMSO) were purchased from Sinopharm Group Company Limited (Shanghai, China). Glyceraldehyde-3-phosphate dehydrogenase, glucose transporter-4 (Glut4), phosphor-AMP-activated protein kinase β1 (p-AMPKβ1), and protein kinase B (Akt) primary antibodies and the corresponding second antibodies were purchased from Cell Signaling Technology, Inc. (Beverly, MA, America). RNA extraction kit and RNA polymerase chain reaction (PCR) kit were purchased from Takara Biotechnology Co., Ltd. (Dalian, China). The other reagents were of analytical grade and obtained from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China).
10
Quantification of Gene Expression by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted according to the manufacturer’s instructions using a Tiangen RNA extraction kit (Beijing, China) and the Synthesis of cDNA was performed using a cDNA Synthesis Kit (Takara). The qPCR was conducted on the Applied Biosystems instrument using the SYBR Green Master Mix, following the manufacturer’s protocol (Ding Ning). The quantitative real-time polymerase chain reaction (qRT-PCR) primers were designed by using NCBI (https://www.ncbi.nlm.nih.gov/ ) and the primer was shown in Table S1 . The relative expression was calculated using the 2−ΔΔCT method (Zhuo et al. 2013 (link)). Three biological replicates were used for this study.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!