Q5 hot start high fidelity 2x master mix

Manufactured by New England Biolabs

Sourced in United States, Germany, United Kingdom

The Q5 Hot Start High-Fidelity 2X Master Mix is a pre-mixed and ready-to-use solution designed for high-fidelity PCR amplification. It contains the Q5 High-Fidelity DNA Polymerase, which provides accurate and robust amplification of DNA templates.

Automatically generated - may contain errors

Lab products found in correlation

Qiaquick pcr purification kit, by Qiagen (8 mentions) Nebuilder hifi dna assembly master mix, by New England Biolabs (7 mentions) Ampure xp bead, by Beckman Coulter (7 mentions) Lunascript rt supermix kit, by New England Biolabs (6 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (6 mentions) Dneasy blood tissue kit, by Qiagen (5 mentions) Miseq sequencer, by Illumina (4 mentions) Gibson assembly master mix, by New England Biolabs (4 mentions) Pureyield plasmid miniprep kit, by Promega (4 mentions) Phusion u green multiplex pcr master mix, by Thermo Fisher Scientific (4 mentions) Nebuffer 2, by New England Biolabs (4 mentions) Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (4 mentions) Trizol, by Thermo Fisher Scientific (4 mentions) Rneasy mini kit, by Qiagen (3 mentions) Gel doc ez imager, by Bio-Rad (3 mentions) Sybr safe dna gel stain, by Thermo Fisher Scientific (3 mentions) Qiaquick gel extraction kit, by Qiagen (3 mentions) Miseq platform, by Illumina (3 mentions) Sanger sequencing, by Eurofins (3 mentions) Nebuilder hifi dna assembly kit, by New England Biolabs (3 mentions)

145 protocols using q5 hot start high fidelity 2x master mix

Synthesis of C-less Firefly Luciferase mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasmid DNA encoding Firefly luciferase mRNA under the control of the T7 RNA polymerase promoter (pLGENB1) was used as DNA template in PCR reactions. C-less 5’UTR Firefly luciferase DNA templates were generated by high fidelity PCR using Q5 Hot Start High-Fidelity 2X Master Mix (NEB, Cat. #: M0494), and a forward primer specific for the first 20 nt of the Firefly luciferase CDS with an overhang corresponding to the T7 promoter and a 5’UTR lacking cytidines (See Table S1 for oligonucleotide sequence). The reverse primer annealed to the last 20 nucleotides (nt) of the 3 ’UTR.
C-less 3’UTR Firefly luciferase DNA templates were generated by high fidelity PCR using the Q5 Hot Start High-Fidelity 2X Master Mix (NEB, Cat. #: M0494), and a reverse primer annealing to the last 20 nt of the Firefly luciferase CDS with an overhang containing the stop codon and a 20 nt C-less 3’UTR. The forward primer annealed to the T7 promoter and the first 20 nt of the 5’UTR of Firefly luciferase CDS (See Table S1 for oligonucleotide sequence). PCR amplicons were purified using AMPure XP beads (Beckman Coulter, Cat. #:A63881) and used for in vitro transcription.

Arango D., Sturgill D., Yang R., Kanai T., Bauer P., Roy J., Wang Z., Hosogane M., Schiffers S, & Oberdoerffer S. (2022). Direct epitranscriptomic regulation of mammalian translation initiation through N4-acetylcytidine. Molecular cell, 82(15), 2797-2814.e11.

+ Open protocol

+ Expand

Integrated ORF Amplification and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

The integrated ORF in genomic DNA was amplified by PCR. The PCR products were shotgun sheared with transposon, index labeled, and sequenced with next-generation sequencing technology. The general screen deconvolution strategy and considerations were described in detail in Yang et al.²⁸. The PCR primers were designed in such a way that there is a ~100 bp extra sequence at each end leading up to the mutated ORF region. We used these 2 primers:
Forward: 5′- TGGCACTTGATGTAATTCTCCTTGGA −3′
Reverse: 5′- TTAAAGCAGCGTATCCACATAGCGT −3′
PCR cycling program:
1. 95 C 30 s
2. 98 C 10 s
3. 69 C 30 s (Annealing temperature when using Q5 Hot Start High-
Fidelity 2X Master Mix (New England BioLabs))
4. 72 C 2.5 min
5. Go to Step 2 34 times
6. 72 C 2 min
7. 4 C hold
A full 96-well PCR reaction was used for each gDNA sample. Each PCR reaction is in 50 uL, and with 250 ng gDNA. Q5 Hot Start High-Fidelity 2X Master Mix (New England BioLabs) was used as DNA polymerase. 1/3 of 96 PCR reactions of a gDNA sample were pooled, concentrated with Qiagen PCR cleanup kit, and then purified by 1% agarose gel. The excised bands were purified first by Qiagen Qiaquick kits, then by AMPure XP kit (Beckman Coulter).

Hayes T.K., Aquilanti E., Persky N.S., Yang X., Kim E.E., Brenan L., Goodale A.B., Alan D., Sharpe T., Shue R.E., Westlake L., Golomb L., Silverman B.R., Morris M.D., Fisher T.R., Beyene E., Li Y.Y., Cherniack A.D., Piccioni F., Hicks J.K., Chi A.S., Cahill D.P., Dietrich J., Batchelor T.T., Root D.E., Johannessen C.M, & Meyerson M. (2024). Comprehensive mutational scanning of EGFR reveals TKI sensitivities of extracellular domain mutants. Nature Communications, 15, 2742.

+ Open protocol

+ Expand

Standardized 16S rRNA Gene Amplification and Sequencing

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA from the biofilms of PE and glass, as well as seawater communities, was extracted using the DNeasy PowerBiofilm kit (Qiagen) according to the manufacturer’s instructions, which included a bead-beating step. DNA was quantified using a Qubit® HS DNA kit (Life Technologies Corporation) and samples were diluted to equalize the concentration. PCR amplifications were performed using Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs® inc.) and the primer pair 515F-Y and 926R ([44 (link), 45 (link)], Supplementary Table S1), which amplified regions V4-5 of the 16S rRNA gene of bacteria, using PCR conditions as described previously [45 (link)]. PCR products were purified with Ampliclean magnetic beads (Nimagen, The Netherlands). Index PCR was performed using Illumina Nextera Index Kit v2 adapters. Sample normalization was done with the SequelPrep™ Normalisation Plate Kit (ThermoFisher Scientific) and samples were pooled for sequencing. Pooled libraries were quantified using the NEBNext Library Quant Kit for Illumina (New England Biolabs, UK) and diluted to 4 nM. Negative DNA extraction controls and negative controls for sequencing were processed simultaneously.

Erni-Cassola G., Wright R.J., Gibson M.I, & Christie-Oleza J.A. (2019). Early Colonization of Weathered Polyethylene by Distinct Bacteria in Marine Coastal Seawater. Microbial Ecology, 79(3), 517-526.

+ Open protocol

+ Expand

FOLR1 Gene Amplification and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was isolated using DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany). FOLR1 sequence was subsequently amplified via PCR using Q5 Hot Start High-Fidelity 2X Mastermix (New England Biolabs, Ipswich, MA, USA) and FOLR1 flanking primer pair (forward primer sequence: 5′-AGGGAGGGGTGGTGTCTAAT-3′; reverse primer sequence: 5′-CCTTTGGGCCTGCTTCCTTA-3′ (Metabion, Planegg, Germany). PCR product was afterward cleaned via the NucleoSpin Gel and PCR Clean-Up Kit (Qiagen). The purified PCR product was sent to Eurofins genomics for sequencing.

Daigre J., Martinez-Osuna M., Bethke M., Steiner L., Dittmer V., Krischer K., Bleilevens C., Brauner J., Kopatz J., Grundmann M.D., Praveen P., Eckardt D., Bosio A, & Herbel C. (2024). Preclinical Evaluation of Novel Folate Receptor 1-Directed CAR T Cells for Ovarian Cancer. Cancers, 16(2), 333.

+ Open protocol

+ Expand

SARS-CoV-2 Genome Amplification Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

cDNA synthesis was performed using Luna Script RT Super Mix Kit (New England Biolabs, Ipswich, MA, USA). The reaction mixture had a volume of 20 μL including 4 μL of 5× Luna Script RT Super Mix, 10 μL of purified viral RNA template, and 6 μL of distilled water, according to the manufacturer’s instructions. The synthesized cDNAs were diluted with nuclease-free water and used as templates for direct amplification performed in multiplexed PCR reactions, to generate ~400 bp amplicons tiled across the genome. The multiplex primer set, consisting of two non-overlapping primer pools, was provided by the ARTIC Network (V3 nCov-2019 primers) (ARTIC primer set [14 ]). PCR amplification was carried out using Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs, Ipswich, MA, USA) with 6 μL of cDNA and 3.6 µl of V3 primer pool per a 25 µL reaction. Two separate reactions were carried out for each primer pool, respectively, primer pool 1 (10 µM) and 2 (10 µM). A two-step PCR program was used with an initial step of 98 °C for 30 s, then 35 cycles of 98 °C for 15 s followed by five minutes at 65 °C.

Capozzi L., Bianco A., Del Sambro L., Simone D., Lippolis A., Notarnicola M., Pesole G., Pace L., Galante D, & Parisi A. (2021). Genomic Surveillance of Circulating SARS-CoV-2 in South East Italy: A One-Year Retrospective Genetic Study. Viruses, 13(5), 731.

+ Open protocol

+ Expand

Genomic DNA Isolation and CRISPR Mutant Screening

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was isolated from GFP‐positive N2A cells using the Mouse Direct PCR Kit (Selleck). Target‐specific primers (Table S4, Supporting Information) were used to amplify protospacer‐containing regions with Q5 Hot Start High‐Fidelity 2X Master Mix (NEB) according to the manufacturer's instructions with modifications. The PCR amplicons were re‐annealed for T7EI cleavage assay, and T7EI‐identified mutated products were cloned to pEASY‐Blunt cloning vector (Transgen) for Sanger sequencing.^[⁴² (link),
⁴³ (link)
^]

Cui T., Cai B., Tian Y., Liu X., Liang C., Gao Q., Li B., Ding Y., Li R., Zhou Q., Li W, & Teng F. (2024). Therapeutic In Vivo Gene Editing Achieved by a Hypercompact CRISPR‐Cas12f1 System Delivered with All‐in‐One Adeno‐Associated Virus. Advanced Science, 11(19), 2308095.

+ Open protocol

+ Expand

SARS-CoV-2 Wastewater Sequencing Workflow

Check if the same lab product or an alternative is used in the 5 most similar protocols

ARTIC V4.1 primer panel was purchased from IDT (Artic V4.1 NCOV-2019 Panel, 500rxn, 10011442). Olivar primers were ordered in tubes from Sigma Aldrich and mixed by hand to achieve the final concentration of 15 nanomolar (nM) per primer. Reverse transcription of synthetic RNA control and extracted wastewater RNA were conducted using 8 uL of sample RNA and LunaScript RT SuperMix kit (NEB, E3010), as described in ref. ¹⁷. To avoid bias attributed to reverse transcription, for each sample, the total volume of 10 uL cDNA product were gently homogenized by pipetting then divided into four 2.5 uL aliquots for the downstream PCR amplification reactions (using primer pool 1 and 2 of ARTIC V4.1, and using primer pool 1 and 2 of Olivar). PCR amplification was also performed using Q5 Hot Start High-Fidelity 2X Master Mix (NEB M0494) as described in ref. ¹⁷. PCR products were purified using AmPureTM XP beads (Beckman Coulter Inc., A63880). A high bead-to-sample ratio of 1.8 was applied to maximize the potentials of capturing PCR byproduct. Purified DNA samples were normalized to 20 ng/uL in 25 uL and submitted for amplicon sequencing service at Azenta (EZ-Amplicon), with paired-end (2× 250bp), adapter trimmed Illumina reads output. The concentration of amplicons was measured using Qubit dsDNA HS kit and a Qubit 2.0 fluorometer (Invitrogen).

Wang M.X., Lou E.G., Sapoval N., Kim E., Kalvapalle P., Kille B., Elworth R.A., Liu Y., Fu Y., Stadler L.B, & Treangen T.J. (2023). Olivar: automated variant aware primer design for multiplex tiled amplicon sequencing of pathogens. bioRxiv.

+ Open protocol

+ Expand

Cell Lysis and PCR Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols

After medium removal from the cells, lysis was performed directly in 96‐well plates according to the manufacturer's protocol using QuickExtract lysis reagent (Epicentre). The cell lysates of the triplicates were collected in one single tube. PCR amplification was done, using Q5 Hot Start High‐Fidelity 2X Master Mix (#M0494, New England Biolabs) according to manufacturer's protocol. The enzyme digest of mispaired dsRNA was done using Surveyor endonuclease (#M0302, New England Biolabs) according to the manufacturer's protocol. The DNA was loaded on bioanalyzer using HS DNA kit.

Serçin Ö., Reither S., Roidos P., Ballin N., Palikyras S., Baginska A., Rein K., Llamazares M., Halavatyi A., Winter H., Muley T., Jurkowska R.Z., Abdollahi A., Zenke F.T., Neumann B, & Mardin B.R. (2019). A solid‐phase transfection platform for arrayed CRISPR screens. Molecular Systems Biology, 15(12), e8983.

+ Open protocol

+ Expand

CRISPR Library Preparation and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

gDNA was extracted from cells using the JetQuick Blood and Cell Culture DNA Midiprep Kit (Thermo Fisher). PCR was then used to amplify the sgRNA inserts and append Illumina adaptors and hexamer barcodes to the amplicons. See Supplemental S8 for primer sequences and thermocycling. PCR was performed using the Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs). Before creating the amplicon library, dPCR was used to assay the copy number of sgRNA inserts in extracted genomic DNA. Sufficient genomic DNA template was used to ensure a minimum read depth of 300 per sample. PCR products were then pooled, concentrated by isopropanol precipitation, and gel purified on a 2% agarose gel before sequencing. Gel extraction was carried out with the PureLink Gel Extraction kit (Thermo Fisher). The purified, barcoded amplicon libraries were then pooled and sequenced as single-read 50 bp reads on the Illumina HiSeq 4,000 (Illumina).

Sharon D.M., Nesdoly S., Yang H.J., Gélinas J.F., Xia Y., Ansorge S, & Kamen A.A. (2020). A pooled genome-wide screening strategy to identify and rank influenza host restriction factors in cell-based vaccine production platforms. Scientific Reports, 10, 12166.

+ Open protocol

+ Expand

Verifying ASCC1 Deletion in Patient Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

A 130-bp PCR product was amplified using the following primers, which are flanking the deletion ASCC1-del-D (5′-gccaaactctttttcacagagg-3′) and ASCC1-del-R2 (5′-gctcggcttgttctgttttc-3′) to confirm the mutation in the patient-derived cells. In order to confirm an intact ASCC1 sequence in the control cells, a 215-bp PCR product was amplified using the following primers: ASCC1-del-D (5′-gccaaactctttttcacagagg-3′) and ASCC1-WT-R (5′-tggctaacaagcagaactgg-3′). The PCR was performed with Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs, Frankfurt, Germany) and under the following thermocycling conditions: 30 s at 98°C followed by 31 cycles of 98°C for 10 s, 60°C for 30 s, and 72°C for 15 s, and another 7 min at 72°C. The amplification products were analyzed for their purity and size by agarose gel electrophoresis. After that, they were treated with Exo-CIP Rapid PCR Cleanup (New England Biolabs, Frankfurt, Germany) and sent to Eurofins for Sanger sequencing.

Voraberger B., Mayr J.A., Fratzl-Zelman N., Blouin S., Uday S., Kopajtich R., Koedam M., Hödlmayr H., Wortmann S.B., Csillag B., Prokisch H., van der Eerden B.C., El-Gazzar A, & Högler W. (2023). Investigating the role of ASCC1 in the causation of bone fragility. Frontiers in Endocrinology, 14, 1137573.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!